GSK3-Mediated BCL-3 Phosphorylation Modulates Its Degradation and Its Oncogenicity

Abstract

The oncoprotein BCL-3 is a nuclear transcription factor that activates NF-kappaB target genes through formation of heterocomplexes with p50 or p52. BCL-3 is phosphorylated in vivo, but specific BCL-3 kinases have not been identified so far. In this report, we show that BCL-3 is a substrate for the protein kinase GSK3 and that GSK3-mediated BCL-3 phosphorylation, which is inhibited by Akt activation, targets its degradation through the proteasome pathway. This phosphorylation modulates its association with HDAC1, -3, and -6 and attenuates its oncogenicity by selectively controlling the expression of a subset of newly identified target genes such as SLPI and Cxcl1. Our results therefore suggest that constitutive BCL-3 phosphorylation by GSK3 regulates BCL-3 turnover and transcriptional activity.

MDM2 restrains estrogen-mediated AKT activation by promoting TBK1-dependent HPIP degradation

“…Human primary fibroblasts, RAW 264.7 and HEK293 cells were maintained in culture as described, 27,39,40 whereas ZR-75, MCF7 and MDA-MB-231 cells were cultured in RPMI and DMEM, respectively, and supplemented with 10% fetal calf serum and antibiotics, as were p53-deficient MCF7 cells. For E2 treatments (10 nM), control or p53-deficient MCF7 cells were first cultured for 48 h with DMEM without phenol red supplemented with Charcoal/Dextran-treated FBS (DCC) (Hyclone/Fisher, Waltham, MA, USA) followed by 24 h without serum.…”

“…27,42 IPs involving ectopically expressed or endogenous proteins were carried out as described. 40,43 For the detection of endogenous polyubiquitinated forms of HPIP (Figure 4h), MCF7 cells were pretreated with MG132. Unstimulated or E2-treated MCF7 cells were lysed in a denaturing lysis buffer (Tris HCl 50 mM pH 8.0 , NaCl 150 mM, NP40 1%, deoxycholate Na 0.5%, SDS 1%).…”

Mutations in the NF-κB signaling pathway: implications for human disease

“…The hypothesis that increased expression of BCL-3 contributes to human B-cell malignancies is supported by several findings: (1) transgenic mice in which BCL-3 is under the control of the m heavy chain enhancer develop splenomegaly and have excess mature B cells in their bone marrow and lymph nodes (Ong et al, 1998); (2) overexpression of BCL-3 can transform mouse 3T3 cells in culture (Viatour et al, 2004); (3) overexpression of BCL-3 can enhance the survival of activated T cells (Mitchell et al, 2001) and (4) elevated levels of BCL-3 are seen in many lymphoid and non-lymphoid human tumor samples (Cogswell et al, 2000;Rassidakis et al, 2003;Canoz et al, 2004;Pallares et al, 2004;Ohno et al, 2005;Schlette et al, 2005). Oncogenically activating mutations within the coding region of BCL-3 have not been identified; however, such mutations may exist in that certain point mutations can enhance the transforming activity of BCL-3 in vitro (Viatour et al, 2004).…”

“…As such, overexpression of BCL-3 is expected to result in increased transcription of genes normally regulated by p52 or p50 homodimers. The genes responsible for BCL-3-induced oncogenesis have not been extensively identified, but may include CY-CLIN D1 (Westerheide et al, 2001) and SLP1 (Viatour et al, 2004). However, BCL-3 may have cancer-related activities other than facilitating p50/p52 transcription.…”

Matrix Metalloproteinase-9 gene induction by a truncated oncogenic NF-κB2 protein involves the recruitment of MLL1 and MLL2 H3K4 histone methyltransferase complexes

“…Retroviral infections of NIH3T3 cells were performed as described (Viatour et al, 2004). For lentiviral infections of HUT-78 cells, 293FT cells were transfected with 12 mg of the 'non-target' lentiviral shRNA plasmid (used as negative control) or the shRNA construct that targets p100/p52 (NM_002502.2) with the following sequence 5 0 -CCGG CCCTATCACAAGATGAAGATTCTCGAGAATCTTCAT CTTGTGATAGGGTTTTT-3 0 and with 12 and 5 mg of R8.91 and VSVG plasmids, respectively.…”