Growth Phase Dependant Activation of the Precursor of Vibrio mimicus Hemolysin (Pro-VMH)

Abstract

Vibrio mimicus (V. mimicus), a causative agent of gastroenteritis and food poisoning, secretes a 63-kDa enterotoxic hemolysin as the most potent virulence factor. The vmhA gene encoding an 83-kDa precursor of the hemolysin was expressed from the early to late log phase of the bacterial growth, and the 79-kDa inactive protoxin was detected from the culture supernatant in the same growth phase. The N-terminal amino acid sequence of the protoxin was determined to be NH 2 -Asn-Ile-Ser-Asp-Pro-Val indicating cleavage of the Ala 25 -Asn 26 bond by a signal peptidase. In contrast, the hemolytic activity and the mature hemolysin in the culture supernatant were detected only at the late log phase. The maturation of the hemolysin, therefore, is suggested to be achieved by two-step processing, cleavage of the signal peptide followed by the growth phase-dependent removal of the 16-kDa propeptide.

Modulation of Vibrio mimicus hemolysin through limited proteolysis by an endogenous metalloprotease

“…Recently, in vitro studies have demonstrated that the enterotoxic action of VMH may be linked to the activation of cyclic AMP‐dependent and Ca 2+ ‐dependent Cl − secretory pathways [7,10]. VMH is a single‐chain polypeptide and is secreted from bacterial cells as an 80 kDa (80 399 Da) precursor (pro‐VMH), which is later converted to the 66 kDa (65 997 Da) mature toxin through removal of an N‐terminal propeptide [11]. However, the proteolytic enzyme(s) mediating toxin maturation has not been identified to date.…”

Role of the Enterotoxic Hemolysin in Pathogenicity of Vibrio mimicus

“…This antibody was highly specific because, in Western blot analysis of the culture supernatant, only the VMH antigen was reacted with the antibody. 6) As shown in Fig. 1, the antibody significantly (p < 0.05) neutralized the FA ability of either strain.…”

“…VMH is secreted from the bacterial cell as an 80-kDa (80399 Da) precursor and, in turn, converted to a 66-kDa (65997 Da) mature form through proteolytic removal of a N-terminal propeptide. 6) When administrated into a rabbit ligated ileal loop, the mature toxin elicits the fluid accumulation (FA) in a dose-dependent manner. 4) Recent in vitro experiments using cultured mammalian cells revealed that the FA by VMH might be linked to activation of the cyclic adenosine 5 -monophosphate (AMP)-dependent and Ca 2+ -dependent Cl − secretory pathways.…”

Presence of the Hemolysin Gene of Vibrio mimicus in Fish and Seafood Products in Sonora, Mexico

“…Species identification was based on amplification of the hemolysin gene of V. mimicus (vmh) (Shinoda et al, 2004;Sultan et al, 2007). A 390-bp region of vmh was used as amplification primers in this study, Vmh390F: GGTAGCCATCAGTCTTATCACG and Vmh390R: ATCGTGTCCCAATACTTCACCG.…”

“…mimicus produces several extracellular toxic factors, but the most common factor is a heat-labile hemolytic/cytolytic toxin known as V. mimicus hemolysin or VHM (Mizuno et al, 2009;Mizuno, Nanko, Maehara, Shinoda, & Miyoshi, 2014). The VHM gene, vmh, is common to clinical and environmental V. mimicus strains, and it is a species-specific identifier (Shinoda et al, 2004;Sultan et al, 2007). Currently, V. mimicus is recognized as a human pathogen in the United States by the FDA (Food and Drug Administration), and it is described briefly in their Bacteriology Analytical Manual (Kaysner & DePaola, 2004).…”