Growth hormone from striped catfish (Pangasianodon hypophthalmus): Genomic organization, recombinant expression and biological activity

Poen, Sinothai; Pornbanlualap, Somchai

doi:10.1016/j.gene.2013.01.014

Cited by 6 publications

(5 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It is secreted in pituitary gland and subsequently binds to growth hormone receptor in the target organ such as liver, and initiates intracellular signaling pathways which finally results in stimulation of somatic growth [21]. Growth hormones have been isolated from different groups of vertebrates including: mammals, birds, reptiles, amphibians and fish [38].…”

Section: Introductionmentioning

confidence: 99%

“…The biological activity of several exogenous recombinant fish growth hormones have been reported [18], [24], [49]. The growth hormones from rabbit fish [18], gold fish [8], [29], common carp [17], striped catfish [38], gilthead sea bream [4], dolphinfish [34], flounder [24], yellow porgy [48], striped bass [10], Indian major carp [47], and salmon [43] have been successfully produced in E. coli.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

High level expression and purification of recombinant flounder growth hormone in E. coli

Choi

Geletu

2018

Journal of Genetic Engineering and Biotechnology

View full text Add to dashboard Cite

Recombinant flounder growth hormone was overproduced in E. coli by using codon optimized synthetic gene and optimized expression conditions for high level production. The gene was cloned into PET-28a expression vector and transformed into E. coli BL21 (DE3). Induction at lower temperature, lower IPTG concentrations and richer growth media during expression resulted in increased expression level. The protein expression profile was analyzed by SDS-PAGE, the authenticity was confirmed by western blotting and the concentration was determined by Bradford assay. In addition, several attempts were made to produce soluble product and all resulted in insoluble product. The overexpressed protein was efficiently purified from inclusion bodies by moderate speed centrifugation after cell lysis. Among the solubilization buffers examined, buffer with 1% N-lauroylsarcosine in the presence of reducing agent DTT at alkaline pH resulted in efficient solubilization and recovery. The denaturant was removed by filtration and dialysis. The amount of the growth hormone recovered was significantly higher than previous reports that expressed native growth hormone genes in E. coli. The methodology adapted in this study, can be used to produce flounder growth hormone at large scale level so that it can be used in aquaculture. This approach may also apply to other proteins if high level expression and efficient purification is sought in E. coli.

show abstract

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

High level expression and purification of recombinant flounder growth hormone in E. coli

Choi

Geletu

2018

Journal of Genetic Engineering and Biotechnology

View full text Add to dashboard Cite

show abstract

“…To characterize the 5′ flanking region of the C. macropomum GH gene (cmGH) gene, we applied the Thermal Asymmetric Interlaced PCR (TAIL‐PCR) methodology (Liu & Whittier, 1995), which permits amplification of an unknown genomic region for which only partial sequence information is available (Session et al., 2002). The coding region of the GH gene being highly conserved among vertebrates (Ma et al., 2012), we inferred the positions of introns within the cmGH gene by aligning complete GH sequences from other fish species (Almuly et al., 2000; Ber & Daniel, 1992; Ma et al., 2011; Poen & Pornbanlualap, 2013; Sekkali et al., 1999; Yowe & Epping, 1995). As the exon‐I sequence is not transcribed into the GH mature hormone because it is part of the signal peptide sequence (Miller & Eberhardt, 1983), we characterized GH intron‐I based on the cDNA sequence of the GH gene for C. macropomum (Souza et al., 2016; GenBank: ) to design the primers (TambF‐1: ATGGCTAAAGGATTGGTGCTGCTC; TambR‐224: GAGTCAGAATTGCAGAAGGACAG) using the Primer3 tool (Untergasser et al., 2012).…”

Section: Methodsmentioning

confidence: 99%

Identification and analysis of a novel microsatellite marker within the growth hormone gene promoter of Colossoma macropomum (Characiformes: Characidae) detected by TAIL‐PCR

et al. 2021

View full text Add to dashboard Cite

Summary While in all vertebrates, growth hormone (GH) promotes post‐natal growth, in fishes it also affects such metabolic functions as foraging rate, digestion, osmoregulation, and reproduction. The promoter region of the GH gene is an important target for studies of mechanisms regulating its expression, and polymorphisms within the promoter have been associated with performance traits in fishes. We used Thermal Asymmetric Interlaced PCR (TAIL‐PCR) to amplify and sequence the 5′‐flanking regions of the Colossoma macropomum GH (cmGH) gene. Based on a sequence of 1,038 bp, we designed three specific nested primers (R‐290, R‐186 and R‐26) which were used with shorter arbitrary degenerate primers to amplify the 5′ proximal region of the cmGH gene. We identified a tetranucleotide (ATCC)4 microsatellite motif in this region, exhibiting four alleles (118, 122, 126 and 130 bp) within the population study. Genotypes at this locus deviated significantly from Hardy–Weinberg expectations (p ≤ .05) and showed a low level of polymorphism (polymorphic information content = 0.163). High homozygosity (FIS = 0.147) was observed in the overall population. The polymorphism at the microsatellite makes it an important candidate for association studies between the respective genotypes, growth rate and other traits in farmed populations. Such studies may contribute to future breeding programs using marker‐assisted selection upon this aquaculturally important species.

show abstract

“…Subsequent purification by Q-Sepharose chromatography resulted in a yield of $2.5 mg monomeric GH from 1 L bacterial culture (Funkenstein et al, 2005). Striped catfish GH was solubilized from inclusion bodies with 2 M urea solution in the present of 1% Trixton X-100, pH 11, and yielded 31 mg from 1 L of cell culture following IMAC purification (Poen & Pornbanlualap, 2013). Flounder GH with an N-terminal His-tag was not soluble, even when induced at 18 C. But it was possible to solubilize it from inclusion bodies by including 0.1% N-lauroylsarcosine in the denaturant buffer.…”

Section: Refolding the Protein From Inclusion Bodiesmentioning

confidence: 99%

“…Although the formation of inclusion bodies has certain advantages, such as protecting the protein from proteolysis and ease of isolation, precipitation as inclusion bodies poses a major hurdle in the recovery of bioactive proteins (Kim, Park, et al, 2013 ; Nguyen et al, 2014 ). Numerous studies have attempted to refold GH orthologues originating from different species from inclusion bodies (e.g., human, bovine, ovine, porcine, and fish; Aramvash et al, 2018 ; Choi & Geletu, 2018 ; Chung et al, 2015 ; Crivelli et al, 1991 ; Fradkin et al, 2010 ; Funkenstein et al, 2005 ; George et al, 1985 ; Jeh et al, 1998 ; Keshavarz et al, 2021 ; Khan et al, 1998 ; Mahmoud et al, 1998 ; Mukhija et al, 1995 ; Mukhopadhyay & Sahni, 2002 ; Ocłoń et al, 2018 ; Paduel et al, 1999 ; Panda et al, 1999 ; Patra et al, 2000 ; Poen & Pornbanlualap, 2013 ; Promdonkoy et al, 2004 ; Rao et al, 1997 ; Sereikaite et al, 2007 ; Shin et al, 1998 ; Singh et al, 2009 , 2012 ; Sonoda & Sugimura, 2008 ; Upadhyay et al, 2012 ; Wallis & Wallis, 1990 ; Wingfield et al, 1987 ; Zomorrodipour et al, 2004 ). A summary of the approaches for refolding GH or GHA from inclusion bodies is listed in Table 3 .…”

Section: Recombinant Gh / Gha P...mentioning

confidence: 99%

Growth hormone receptor agonists and antagonists: From protein expression and purification to long‐acting formulations

et al. 2023

View full text Add to dashboard Cite

Recombinant human growth hormone (rhGH) and GH receptor antagonists (GHAs) are used clinically to treat a range of disorders associated with GH deficiency or hypersecretion, respectively. However, these biotherapeutics can be difficult and expensive to manufacture with multiple challenges from recombinant protein generation through to development of long‐acting formulations required to improve the circulating half‐life of the drug. In this review, we summarise methodologies and approaches used for making and purifying recombinant GH and GHA protein, and strategies to improve pharmacokinetic and pharmacodynamic properties, including PEGylation and fusion proteins. Therapeutics that are in clinical use or are currently under development are also discussed.This article is protected by copyright. All rights reserved.

show abstract

Growth hormone from striped catfish (Pangasianodon hypophthalmus): Genomic organization, recombinant expression and biological activity

Cited by 6 publications

References 31 publications

High level expression and purification of recombinant flounder growth hormone in E. coli

High level expression and purification of recombinant flounder growth hormone in E. coli

Identification and analysis of a novel microsatellite marker within the growth hormone gene promoter of Colossoma macropomum (Characiformes: Characidae) detected by TAIL‐PCR

Growth hormone receptor agonists and antagonists: From protein expression and purification to long‐acting formulations

Contact Info

Product

Resources

About