Growth Factor Receptors

Sp1 is required for transcriptional activation of the fibroblast growth factor receptor 1 gene in neonatal cardiomyocytes

“…Sp transcription factors comprise a family of four C 2 H 2 zinc-finger DNA binding proteins (Sp1-4) that regulate basal and inducible transcription of many genes. They bind to GC boxes (GGGCGG), GT motifs (GGGTGTGGC), or CT elements (CCTCCTCCTCCTCGGCCTCCTCCCC) (Parakati and DiMario, 2004). Sp1, Sp2, and Sp4 often function as activators of promoter activity, whereas Sp3 can function as either a transcriptional activator or repressor (Hagen et al, 1994;Li et al, 2004).…”