Growing diversity supports radiation of an Ellipsomyxa lineage into the Amazon freshwater: Description of two novel species parasitizing fish from Tapajós and Amazon rivers

Myxozoan Ceratomyxids Infecting the Gallbladder of Amazonian Ornamental Cichlid Fish: Description of Ellipsomyxa santarenensis n. sp. and Report of Ceratomyxa amazonensis in a New Host

“…sp., with 1.6% divergence. Although there is no definition of the exact interspecific genetic distance to define species [23], careful analysis supported that the level of interspecific difference in the genus Ellipsomyxa can be as low as 0.5% between Ellipsomyxa gobii Køie, 2003 and Ellipsomyxa syngnathi Køie & Karlsbakk, 2009, 0.3% between E. syngnathi and Ellipsomyxa mugilis (Sitja-Bobadilla & Alvarez-Pellitero, 1993), and 0.2% between Ellipsomyxa nigropunctatis Heiniger & Adlard, 2014 and Ellipsomyxa arothroni Heiniger & Adlard, 2014 (see Table 3 in Zatti et al [17]). Thus, based on morphological and molecular differences, E. santarensensis n. sp.…”

“…Initial amplification for Ceratomyxa was performed using the universal primers 18E (CTGGTTGATTCTGCCAGT; [27]) and 18R (CTACGCAAACCTTGTTACG; [24]) primers, followed by a second round with Ceratomyxa-specific primers CerSAZ.1f (GTCCCTTC-GATCGTAGTACCAC; [15]) and CerSAZ.3r (CTATCCCCACAGCCTGAAAACT; [15]), CerSAZ.4f (GTTGGTTAGTTTCCACGCGAAA; [15]) with 18R. For Ellipsomyxa, amplification was performed with ERIB1 (ACCTGGTTGATCCTGCCAG; [28]) and ERIB10 (CTTC-CGCAGGT TCACCTACGG; [28]) primers, followed by a second round with ERIB1 and Ellipso.3r (CCAACAACTGAACCTTGTCATGG; [17]), Ellipso.4f (AACCACTCGTGCATT-TAATCGTG; [17]) with ERIB10. Quantification and size estimation were determined by running the PCR products against a 1 Kb Plus DNA Ladder (Thermo Scientific, Carlsbad, CA, USA) through a 1.5% agarose gelin TBE buffer (0.045 M Tris-borate, 0.001 M EDTA pH 8.0).…”

“…Amplicon sequences were aligned with all SSU rDNA sequences of Ellipsomyxa species available plus representative sequences of other genera based on the groupings obtained by Zatti et al [17] using the default parameters of the Muscle algorithm [30] run on Geneious 7.1.3 [31]. The DNA-SSU rDNA sequences for Buddenbrockia plumatellae KF731698 and Tetracapsuloides bryosalmonae KF731712 were chosen as outgroups.…”

“…Ellipsomyxa spp. have been mainly isolated from the gallbladders of fish caught in marine, brackish and estuarine waters, with some species having recently been described infecting freshwater fish from the Amazon Basin [16][17][18][19].…”

Fauna parasitaria de dos peces del género satanoperca (cichlidae): una revisión de las investigaciones realizadas en el siglo XXI

“…Con respecto a Ellipsomyxa (Køie, 2003), este es un género de mixozoos que pertenece a la Clase Myxosporea y familia Ceratomyxidae (Køie, 2003) y que a la fecha solo tiene a cuatro especies reportadas como parásitos de peces amazónicos, Ellipsomyxa amazonensis (Zatti et al, 2018), E. plagioscioni y E. paraensis (Zatti et al, 2020), siendo la cuarta, E. tucujuensis, aislada de la vesícula biliar de S. jurupari (Ferreira et al, 2021).…”