Green fluorescent protein expression and colocalization with calretinin, parvalbumin, and somatostatin in the GAD67‐GFP knock‐in mouse

Abstract

␥-aminobutyric acid (GABA)ergic neurons in the central nervous system regulate the activity of other neurons and play a crucial role in information processing. To assist an advance in the research of GABAergic neurons, here we produced two lines of glutamic acid decarboxylase-green fluorescence protein (GAD67-GFP) knock-in mouse. The distribution pattern of GFP-positive somata was the same as that of the GAD67 in situ hybridization signal in the central nervous system. We encountered neither any apparent ectopic GFP expression in GAD67-negative cells nor any apparent lack of GFP expression in GAD67-positive neurons in the two GAD67-GFP knock-in mouse lines. The timing of GFP expression also paralleled that of GAD67 expression. Hence, we constructed a map of GFP distribution in the knock-in mouse brain. Moreover, we used the knock-in mice to investigate the colocalization of GFP with NeuN, calretinin (CR), parvalbumin (PV), and somatostatin (SS) in the frontal motor cortex. The proportion of GFP-positive cells among NeuN-positive cells (neocortical neurons) was approximately 19.5%. All the CR-, PV-, and SS-positive cells appeared positive for GFP. The CR-, PV, and SS-positive cells emitted GFP fluorescence at various intensities characteristics to them. The proportions of CR-, PV-, and SS-positive cells among GFP-positive cells were 13.9%, 40.1%, and 23.4%, respectively. Thus, the three subtypes of GABAergic neurons accounted for 77.4% of the GFP-positive cells. They accounted for 6.5% in layer I. In accord with unidentified GFP-positive cells, many mediumsized spherical somata emitting intense GFP fluorescence were observed in layer I.

Altered proliferative ability of neuronal progenitors in PlexinA1 mutant mice

“…To confirm that PlexinA1 is expressed in cortical interneurons, we used coronal sections from E14.5 GAD67‐GFP mice (Tamamaki et al, 2003b). Double labeling for PlexinA1 and GFP revealed colocalization in the mantle zones of the MGE and LGE as well as in the IZ and MZ of the cortex (Fig.…”

“…Animals (Scientific Procedures) Act 1986 and institutional guidelines. Wild‐type animals were C57/bl6J mice obtained from Charles River, Ltd. PlexinA1 −/− and GAD67‐GFP neo‐ mice were generated as described previously (Yoshida et al, 2006 [PMID: 17145500]; Tamamaki et al, 2003b [PMID: 14574680]). PlexinA1 mice were genotyped by polymerase chain reaction (PCR) with the following primers: WT‐forward (5′‐CCTGCAGATTGATGACGACTTCTGC‐3′), WT‐reverse (5′‐TCATGCAGACCCAGTCTCCCTGTCA‐3′), product size 200 bp; and mutant‐forward (5′‐GCATGCCTGTGACACTTGGCTCACT‐3′), mutant‐reverse (5′‐CCATTGCTCAGCGGTGCTGTCCATC‐3′), product size 600 bp.…”

The Effect of Sevoflurane Inhalation on Gabaergic Neurons Activation: Observation on the GAD67‐GFP Knock‐In Mouse

“…In this study, 20 male GAD67-GFP knock-in mice (heterozygote) aged 12 weeks were used. It has been confirmed that GAD67-GFP knock-in mice exhibit normal growth, normal reproductive behavior, and no abnormality in the brains at macroscopic level (Tamamaki et al, 2003). All experimental procedures were approved by the Committee of Animal Use for Research and Education of the Fourth Military Medical University (Xi'an, P. R. China).…”

“…The production of the GAD67-GFP knock-in mice has been already reported (Tamamaki et al, 2003). In this study, 20 male GAD67-GFP knock-in mice (heterozygote) aged 12 weeks were used.…”

“…In this study, we used transgenic mice coexpressing enhanced green fluorescent protein (GFP) and GABAsynthesizing enzyme glutamic acid decarboxylase (GAD) 67 to characterize GABAergic neurons in CNS (Tamamaki et al, 2003). The GAD67-GFP knock-in mouse has been proved to be a very useful tool to observe the morphology of GABAergic neurons, which were revealed by GFP expression (Huang et al, 2008).…”