Grapevine virus L: a novel vitivirus in grapevine

Abstract

Vitivirus are ssRNA(+) viruses in the family Betaflexiviridae (subfamily Trivirinae). There are currently ten ICTV recognized virus species in the genus; nevertheless, the extended use of NGS technologies is rapidly expanding their diversity and six more have been proposed recently. Here, we present the characterization of a novel virus from grapevines, which fits the genomic architecture and evolutionary constraints to be classifiable within the Vitivirus genus. The detected virus sequence is 7,607 nt long, including a typical genome organization of ORFs encoding a replicase (RP), a 22 kDa protein, a movement protein, a coat protein (CP) and a nucleic acid binding protein. Here, we present the characterization of a novel virus from grapevines.Phylogenetic analyses based on the predicted RP and CP protein unequivocally places the new virus within the Vitivirus genus. Multiple independent RNAseq data confirmed the presence of the detected virus in berries at diverse developmental stages. Additionally, we detected, confirmed, and assembled virus sequences from grapevine samples of distinct cultivars from America, Europe, Asia and Oceania, sharing 74.9%-97.9% nt identity, suggesting that the identified virus is widely distributed and diverse. We propose the name grapevine virus L (GVL) to the detected Vitivirus.

High-Throughput Sequencing of Small RNAs for the Sanitary Certification of Viruses in Grapevine

“…Sample 33109 (Albillo criollo, Canary Islands) showed contigs matching to vitiviruses ( Supplementary File 1 ). When the contigs were analyzed, they showed the highest similarity to Grapevine virus L (GVL), a vitivirus recently described (MH681991; Debat et al, 2019 ). Specific consensus primers were designed based on the sequences of the contigs matching to the coat protein (CP) gene of the virus (GVLF1: GCAGTCCCTTAGTAGTAATAT and GVLR1: CCACCTGAGACTGAGCATCGA) and used for RT-PCR, resulting one amplicon (488 bp) from the RNA extraction of the sample.…”

Virus and Virus-like Pathogens in the Grapevine Virus Collection of Croatian Autochthonous Grapevine Cultivars

“…In the period from 2009 to 2022, the collection was used for identification and characterization of different viruses such as grapevine leafroll-associated virus 2 (GLRaV-2), GLRaV-4 like group, grapevine viruses B, D, E, and F (GVB, D, E, F), grapevine redglobe virus (GRGV), grapevine Syrah virus 1 (GSyV-1), and grapevine rupestris vein feathering virus (GRVFV), which were detected for the first time in Croatia [ 3 , 4 , 5 ]. Recently, using high-throughput sequencing (HTS) technology, GVG, GVL, and grapevine badnavirus 1 (GBV-1) were reported from the accessions present in the collection [ 6 , 7 ], showing the great virome diversity present in these vines.…”

Detection, Transmission, and Characterization of Grapevine Virus H in Croatia

“…In the period from 2016 to 2020 alone, 28 different viruses were reported using HTS. Among them, six new members of the genus Vitivirus were reported: grapevine virus G (GVG) and grapevine virus I (GVI) in Chardonnay from New Zealand [9,10]; grapevine virus H (GVH) from an unknown grapevine variety in Portugal [11]; grapevine virus J (GVJ) in the plant of cultivar 'Kisil Sapak' originating from Turkmenistan, but in a vine which was part of the Foundation Plant Services collection (FPS, UC -Davis, CA) [12]; grapevine virus L (GVL) in vines from Croatia, Canada, New Zealand, and China [13]; and grapevine virus M (GVM) from the hybrid Blanc du Bois in Texas [14]. The first discovered members of the genus Vitivirus, grapevine virus A (GVA) from grapevines in Italy showing symptoms of a pitted stem [15] and grapevine virus B (GVB) from grapevines with corky bark from Europe and North America [16], are known to be members of the so-called rugose wood complex and, depending on the rootstock/scion combination and climatic conditions, negatively affect grapevine production [17][18][19].…”