Golgi Phosphoprotein 3 Confers Radioresistance via Stabilizing EGFR in Lung Adenocarcinoma

Chen, Guodong; Kong, Peizhong; Yang, Miaomiao; Hu, Wanglai; Prise, Kevin M.; Yu, K.N.; Cui, Shujun; Qin, Feng; Ma, Gang; Almahi, Waleed Abdelbagi; Nie, Lili; Han, Wei

doi:10.1016/j.ijrobp.2021.11.023

Cited by 4 publications

(6 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In our study, we confirmed that GOLPH3 could be a potential molecular target for modulating the RIBE. Together with our recent identification of GOLPH3 as a radiosensitization target in lung cancer [ 27 ], the inhibition of GOLPH3 in radiotherapy appears to kill these “two birds” with one stone, so targeting GOLPH3 may be a promising strategy to achieve therapeutic benefit in radiotherapy.…”

Section: Discussionmentioning

confidence: 99%

“…The plasmids, GV248-NC (the negative control), GV248-hGOLPH3-RNAi#1 and GV248-hGOLPH3-RNAi#2, were constructed to knockdown human GOLPH3 (hGOLPH3), as described in our previous study [ 27 ]. The shRNA target sequences of hGOLPH3 were as follows: GCATGTTAAGGAAACTCAGCC (RNAi#1) and GCAGCGCCTCATCAAGAAAGT (RNAi#2).…”

Section: Methodsmentioning

confidence: 99%

“…The recombinant adenovirus expression vector of GOLPH3 (pHBAd-mCMV-3×Flag-hGOLPH3Res-IRES-EGFP), containing a GOLPH3 isoform with silent mutations in the GOLPH3-RNAi#2-binding sites (hGOLPH3-Res), was also constructed for adenovirus package in our previous study [ 27 ]. The adenovirus expressing the hGOLPH3-Res gene was prepared by Hanbio Co., Ltd. (Shanghai, China).…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Golgi Phosphoprotein 3 Mediates Radiation-Induced Bystander Effect via ERK/EGR1/TNF-α Signal Axis

Qin

Chen

et al. 2022

Antioxidants

Self Cite

View full text Add to dashboard Cite

The radiation-induced bystander effect (RIBE), an important non-targeted effect of radiation, has been proposed to be associated with irradiation-caused secondary cancers and reproductive damage beyond the irradiation-treated area after radiotherapy. However, the mechanisms for RIBE signal(s) regulation and transduction are not well understood. In the present work, we found that a Golgi protein, GOLPH3, was involved in RIBE transduction. Knocking down GOLPH3 in irradiated cells blocked the generation of the RIBE, whereas re-expression of GOLPH3 in knockdown cells rescued the RIBE. Furthermore, TNF-α was identified as an important intercellular signal molecule in the GOLPH3-mediated RIBE. A novel signal axis, GOLPH3/ERK/EGR1, was discovered to modulate the transcription of TNF-α and determine the level of released TNF-α. Our findings provide new insights into the molecular mechanism of the RIBE and a potential target for RIBE modulation.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Golgi Phosphoprotein 3 Mediates Radiation-Induced Bystander Effect via ERK/EGR1/TNF-α Signal Axis

Qin

Chen

et al. 2022

Antioxidants

Self Cite

View full text Add to dashboard Cite

show abstract

“…EGFR is overexpressed in 40% to 80% of patients with NSCLC and is associated with poor prognosis ( 101 , 102 ). Radiation can stimulate wild-type EGFR to enter nucleus and bind with DNA-PK catalytic subunit (DNA-PKcs) to promote DNA repair, thus leading to radioresistance of NSCLC ( 103 , 104 ). However, the NSCLC with mutant EGFR is not necessarily more sensitive to radiation ( 94 ), since the mutant EGFR can trigger the downstream pathways, including extracellular signal-regulated kinase (RAS/ERK), p38MAPK, c-Jun N-terminal kinase (JNK), and ERK5, and also activate PI3K/AKT/mTOR signaling pathway, leading to cell proliferation and anti-apoptosis, migration, DNA repair, cell cycle arrest, etc., which in turn increases the radioresistance of NSCLC ( 22 , 23 , 103 , 105 – 108 ).…”

Section: Mechanisms Of Inherent Radioresistancementioning

confidence: 99%

Review: Mechanisms and perspective treatment of radioresistance in non-small cell lung cancer

Zhou

Zhang²,

He³

et al. 2023

Front. Immunol.

View full text Add to dashboard Cite

Radiotherapy is the major treatment of non-small cell lung cancer (NSCLC). The radioresistance and toxicity are the main obstacles that leading to therapeutic failure and poor prognosis. Oncogenic mutation, cancer stem cells (CSCs), tumor hypoxia, DNA damage repair, epithelial-mesenchymal transition (EMT), and tumor microenvironment (TME) may dominate the occurrence of radioresistance at different stages of radiotherapy. Chemotherapy drugs, targeted drugs, and immune checkpoint inhibitors are combined with radiotherapy to treat NSCLC to improve the efficacy. This article reviews the potential mechanism of radioresistance in NSCLC, and discusses the current drug research to overcome radioresistance and the advantages of Traditional Chinese medicine (TCM) in improving the efficacy and reducing the toxicity of radiotherapy.

show abstract

“…Interestingly, several works accumulated in the past years highlighting the role of GOLPH3 in brain tumors, and in some cases the molecular pathways have been identified, such as those involving mTOR, 23,35 Ak strain transforming (AKT), 35,36 Janus kinase 2 / signal transducer and activator of transcription 3, 37 prohibitin 2, 38 and mitogen-activated protein kinase. 39 Additional signaling pathways influenced by GOLPH3 include myosin XVIIIA (MYO18A) in neuroblastoma, 31 AKT, forkhead Box O1, and activating transcription factor 3 in breast 40,41 and colon 42 cancers, JAK2 and STAT3 in colon cancer, 43,44 Wingless-related integration site (Wnt) in colon 45 and ovary 46 cancers, mTOR—beyond brain tumors—in lung, 47 prostate, 48,49 gastric, 50 ovary, 51 and liver 52 cancers, EGFR in lung cancer, 53 and NACHT-LRR-PYD domains-containing protein 3 in gallbladder carcinoma. 54 Lisanti and coworkers linked GOLPH3 function to cancer metabolism, 55,56 while Rizzo et al 13 showed the central role of GOLPH3 in regulating the cellular sphingolipidome, thus promoting growth factor signaling and cell proliferation.…”

Section: Role Of Golph3 In Tumorigenesis: a Brief Overview Of Consoli...mentioning

confidence: 99%

Linking GOLPH3 and Extracellular Vesicles Content—a Potential New Route in Cancer Physiopathology and a Promising Therapeutic Target is in Sight?

Giansanti

Piergentili

2022

Technol Cancer Res Treat

View full text Add to dashboard Cite

Golgi phosphoprotein 3 (GOLPH3), a highly conserved phosphatidylinositol 4-phosphate effector, is required for maintenance of Golgi architecture, vesicle trafficking, and Golgi glycosylation. GOLPH3 overexpression has been reported in several human solid cancers, including glioblastoma, breast cancer, colorectal cancer, nonsmall cell lung cancer, epithelial ovarian cancer, prostate cancer, gastric cancer, and hepatocellular carcinoma. Although the molecular mechanisms that link GOLPH3 to tumorigenesis require further investigation, it is likely that GOLPH3 may act by controlling the intracellular movement of key oncogenic molecules, between the Golgi compartments and/or between the Golgi and the endoplasmic reticulum. Indeed, numerous evidence indicates that deregulation of intracellular vesicle trafficking contributes to several aspects of cancer phenotypes. However, a direct and clear link between extracellular vesicle movements and GOLPH3 is still missing. In the past years several lines of evidence have implicated GOLPH3 in the regulation of extracellular vesicle content. Specifically, a new role for GOLPH3 has emerged in controlling the internalization of exosomes containing either oncogenic proteins or noncoding RNAs, especially micro-RNA. Although far from being elucidated, growing evidence indicates that GOLPH3 does not increase quantitatively the excretion of exosomes, but rather regulates the exosome content. In particular, recent data support a role for GOLPH3 for loading specific oncogenic molecules into the exosomes, driving both tumor malignancy and metastasis formation. Additionally, the older literature indirectly implicates GOLPH3 in cancerogenesis through its function in controlling hepatitis C virus secretion, which in turn is linked to hepatocellular carcinoma formation. Thus, GOLPH3 might promote tumorigenesis in unexpected ways, involving both direct and indirect routes. If these data are further confirmed, the spectrum of action of GOLPH3 in tumor formation will significantly expand, indicating this protein as a strong candidate for targeted cancer therapy.

show abstract

Golgi Phosphoprotein 3 Confers Radioresistance via Stabilizing EGFR in Lung Adenocarcinoma

Cited by 4 publications

References 43 publications

Golgi Phosphoprotein 3 Mediates Radiation-Induced Bystander Effect via ERK/EGR1/TNF-α Signal Axis

Golgi Phosphoprotein 3 Mediates Radiation-Induced Bystander Effect via ERK/EGR1/TNF-α Signal Axis

Review: Mechanisms and perspective treatment of radioresistance in non-small cell lung cancer

Linking GOLPH3 and Extracellular Vesicles Content—a Potential New Route in Cancer Physiopathology and a Promising Therapeutic Target is in Sight?

Contact Info

Product

Resources

About