Gold is a T cell polyclonal activator in BN and LEW rats but favors IL-4 expression only in autoimmune prone BN rats

Savignac, Magali; Badou, Abdallah; Delmas, Christelle; Subra, Jean‐François; Cramer, Stéphane De; Paulet, Pierre; Cassar, Georges; Druet, Philippe; Saoudi, Abdelhadi; Pelletier, Lucette

doi:10.1002/1521-4141(200108)31:8<2266::aid-immu2266>3.0.co;2-6

Cited by 17 publications

(11 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Thus the Lewis mounts a Th1 response and is susceptible to EAE and autoimmune uveoretinitis, both Th1 mediated, while the BN is susceptible to mercuric chloride-induced glomerulopathy 35 and gold salts autoimmunity, 36 both Th2 responses. Cautain et al 25 suggested that the natural resistance of the BN to EAE is associated with a defect in the ability to mount a Th1 response.…”

Section: Discussionmentioning

confidence: 99%

Nitric Oxide Contributes to Resistance of the Brown Norway Rat to Experimental Autoimmune Encephalomyelitis

Staykova

Paridaen

Cowden

et al. 2005

The American Journal of Pathology

View full text Add to dashboard Cite

The Brown Norway (BN) rat is reported to be resistant to the induction of experimental autoimmune encephalomyelitis (EAE) and a number of mechanisms have been suggested to explain this resistance. In work reported here we provide evidence that such resistance in the BN rat can be accounted for, at least in part, by their ability to produce higher levels of nitric oxide (NO) than susceptible strains of rats. Spleen cells from the BN rat make significantly more NO following in vitro stimulation than do cells from the Lewis or PVG rat and following in vivo immunization using complete Freund's adjuvant (CFA) the BN rat makes substantially more NO than either susceptible strain. If carbonyl iron is used as adjuvant in vivo there is no increase in NO levels in the BN rat and they are rendered highly susceptible to EAE. Immunizing with CFA simultaneously with neuroantigen and carbonyl iron drives up NO levels and the resistance is restored. EAE produced using carbonyl iron is characterized by extensive macrophage/microglia presence in the central nervous system lesions of the BN rat yet the cytokine profile in the lymph nodes does not differ from that in the EAE Lewis rats. Nitric oxide (NO) is a free radical produced from the oxidation of the terminal guanidino nitrogen of arginine; the reaction is catalyzed by an NADPH-dependent enzyme, nitric oxide synthase (NOS) of which three isoforms have been described.

show abstract

Section: Discussionmentioning

confidence: 99%

Nitric Oxide Contributes to Resistance of the Brown Norway Rat to Experimental Autoimmune Encephalomyelitis

Staykova

Paridaen

Cowden

et al. 2005

The American Journal of Pathology

View full text Add to dashboard Cite

show abstract

“…PCR products were electrophoresed in a 2% agarose gel with ethidium bromide staining. The predicted sizes of PCRproduct and primer pairs 13 were as follows: β-actin: product size = 759 bp, 5′TTGTAACCAACTGGGACGATATGG3′ and 5′GATCTTGATCTTCATGGTGCTAGG3′; IL-2: product size = 342 bp, 5′CAAAGGAAACACAGCAGCACCTGG3′ and 5′TCCT-CAGAAATTCCACCACAGTTG3′, IL-10: product size = 512 bp, 5′TCAGCACTGCTATGTTGCCTGCTC3′ and 5′ GAGTGTCACG-TAGGCTTCTATGC3′, IFN-γ: product size = 288 bp, 5′ATCT-GGAGGAACTGGCAAAAGGACG3′ and 5′CCTTAGGCTAGAT-TCTGGTGACAGC3′. IL-4 primer pair (GenBank Accession No X16058) was purchased from BioSource International, Camarillo, CA, USA and the predicted size was 177 bp.…”

Section: Assessment Of Cellular Immune Responsesmentioning

confidence: 99%

“…An anti-IFN-γ monoclonal antibody 13 was purchased from U-CyTech bv, Utrecht, Netherlands. Normal mouse IgG was obtained from sera of Balb/c mice by precipitation at 40% saturation with ammonium sulphate, then purified by protein G-Sepharose 4B fast flow chromatography (Pharmacia LKB Biotechnology, Uppsala, Sweden).…”

Section: Reagentsmentioning

confidence: 99%

Exertion of the suppressive effects of IFN-gamma on experimental immune mediated blepharoconjunctivitis in Brown Norway rats during the induction phase but not the effector phase

Fukushima

Fukata²,

Ozaki³

et al. 2002

British Journal of Ophthalmology

View full text Add to dashboard Cite

Background/aims: Interferon gamma (IFN-γ) knockout mice exhibit severe allergic conjunctivitis (AC), indicating that IFN-γ regulates the development of AC. The authors examined whether this inhibitory effect of IFN-γ is exerted during the induction or effector phase of experimental AC. Methods: Experimental immune mediated blepharoconjunctivitis (EC) was induced in Brown Norway (BN) rats, using ovalbumin (OVA) as the antigen. To investigate the role of IFN-γ in the induction phase, EC was induced by active immunisation and IFN-γ (10 µg/time, total 70 µg), or phosphate buffered saline (PBS) as a control, was injected intraperitoneally every other day from the day of immunisation. The rats were challenged with OVA eye drops 13 days after immunisation, and 24 hours later, the eyes were harvested for histology. To examine the effects of IFN-γ in the effector phase, OVA specific T cells were transferred into syngeneic rats and IFN-γ (10 µg/time, total 50 µg) or PBS was injected each day after the transfer until induction of EC 4 days later with an OVA challenge. To investigate the role of endogenous IFN-γ during the effector phase, an anti-IFN-γ monoclonal antibody (3 mg/time) was injected on days 3 and 4. Results: Injection of IFN-γ into actively immunised rats suppressed eosinophilic infiltration but not infiltration of mononuclear cells. In contrast, neither IFN-γ nor anti-IFN-γ affected EC in passively immunised rats. Conclusion: IFN-γ is a suppressive cytokine for the development of EC and exerts this suppressive effect during the induction phase.

show abstract

“…Indeed, for example, ZAP-70 (2) and phospholipase C␥ (3) have been reported to be dispensable for IL-4 production. Furthermore, whereas calcium-dependent signaling was crucial for IL-4 synthesis (4,5), the increase in intracellular calcium concentration ([Ca 2ϩ ] i ) 4 was much lower in Th2 than in Th1 cells on TCR stimulation (6 -8) Heavy metals (mercury or gold) are T cell polyclonal activators resulting in preferential early expression of IL-4 in genetically predisposed animals (9,10). In studying how heavy metals act, we discovered a new signaling pathway implicated in IL-4 synthesis and involving dihydropyridine (DHP)-sensitive channels (11).…”

Section: N Terms Of Cytokine Productions and Functions (Reviewed Inmentioning

confidence: 99%

Dihydropyridine Receptors Are Selective Markers of Th2 Cells and Can Be Targeted to Prevent Th2-Dependent Immunopathological Disorders

Savignac

Gomès

Gallard

et al. 2004

The Journal of Immunology

Self Cite

View full text Add to dashboard Cite

Th1 cells that produce IFN-γ are essential in the elimination of intracellular pathogens, and Th2 cells that synthetize IL-4 control the eradication of helminths. However, highly polarized Th1 or Th2 responses may be harmful and even lethal. Thus, the development of strategies to selectively down-modulate Th1 or Th2 responses is of therapeutic importance. Herein, we demonstrate that dihydropyridine receptors (DHPR) are expressed on Th2 and not on Th1 murine cells. By using selective agonists and antagonists of DHPR, we show that DHPR are involved in TCR-dependent calcium response in Th2 cells as well as in IL-4, IL-5, and IL-10 synthesis. Nicardipine, an inhibitor of DHPR, is beneficial in experimental models of Th2-dependent pathologies in rats. It strongly inhibits the Th2-mediated autoimmune glomerulonephritis induced by injecting Brown Norway (BN) rats with heavy metals. This drug also prevents the chronic graft vs host reaction induced by injecting CD4+ T cells from BN rats into (LEW × BN)F1 hybrids. By contrast, treatment with nicardipine has no effect on the Th1-dependent experimental autoimmune encephalomyelitis triggered in LEW rats immunized with myelin. These data indicate that 1) DHPR are a selective marker of Th2 cells, 2) these calcium channels contribute to calcium signaling in Th2 cells, and 3) blockers of these channels are beneficial in the treatment of Th2-mediated pathologies.

show abstract

Gold is a T cell polyclonal activator in BN and LEW rats but favors IL-4 expression only in autoimmune prone BN rats

Cited by 17 publications

References 29 publications

Nitric Oxide Contributes to Resistance of the Brown Norway Rat to Experimental Autoimmune Encephalomyelitis

Nitric Oxide Contributes to Resistance of the Brown Norway Rat to Experimental Autoimmune Encephalomyelitis

Exertion of the suppressive effects of IFN-gamma on experimental immune mediated blepharoconjunctivitis in Brown Norway rats during the induction phase but not the effector phase

Dihydropyridine Receptors Are Selective Markers of Th2 Cells and Can Be Targeted to Prevent Th2-Dependent Immunopathological Disorders

Contact Info

Product

Resources

About