GneZ, a UDP-GlcNAc 2-Epimerase, Is Required for S-Layer Assembly and Vegetative Growth of Bacillus anthracis

Wang, Yating; Missiakas, Dominique; Schneewind, Olaf

doi:10.1128/jb.01829-14

Cited by 13 publications

(22 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The temperature-sensitive vector pLM4 (25) was used to generate a clone where the tagO gene coding sequence was replaced with the aad9 gene. Briefly, 1-kbp flanking DNA sequences upstream and downstream of the tagO gene were amplified with primer pairs bearing sequences TTTCCCGGGCCTCCCGTAA AAATTCAGGATT, AAACTCGAGATAAATCACTTGTGAGTCCATTA ATACC, AAACTCGAGAAAAAACGCGAAGACTAATTGTAG, and TT TGAATTCCAAAAATAGGAAGGGTGGGAAG and ligated with the intervening spectinomycin resistance cassette aad9 as described previously (14). The resulting DNA fragment was ligated into pLM4 using K1077 (26).…”

Section: Methodsmentioning

confidence: 99%

“…Fixed specimens were observed by light microscopy with a charge-coupled-device (CCD) camera on an Olympus IX81 microscope using a 100ϫ objective. To visualize surface proteins, newly germinated bacilli were incubated with rabbit antisera raised against purified Sap, EA1, and BslR (14,37), and bound antibodies were detected with DyLight594-conjugated goat anti-rabbit secondary antibody (Fisher). Cells were counterstained with boron dipyrromethene (bodipy)-vancomycin (Invitrogen).…”

Section: Methodsmentioning

confidence: 99%

“…However, the replacement of the endogenous gneY promoter with an isopropyl-␤-D-thiogalactopyranoside (IPTG)-inducible spac promoter supports growth of the B. anthracis gneZ mutant (14). Removal of the gneY inducer causes defects in S-layer assembly, suggesting that a UDP-GlcNAc 2-epimerase indeed supplies ManNAc for SCWP synthesis (14). gneY (BAS5048) is located in the same gene cluster as tagO (BAS5050).…”

mentioning

confidence: 99%

“…The gneZ gene (BAS5117), a member of this locus, encodes a UDP-GlcNAc 2-epimerase and catalyzes the conversion of GlcNAc into ManNAc (13). gneZ is essential for B. anthracis growth (14), and its homologue, gneY (BAS5048), is not expressed under vegetative growth conditions (15). However, the replacement of the endogenous gneY promoter with an isopropyl-␤-D-thiogalactopyranoside (IPTG)-inducible spac promoter supports growth of the B. anthracis gneZ mutant (14).…”

mentioning

confidence: 99%

“…gneZ is essential for B. anthracis growth (14), and its homologue, gneY (BAS5048), is not expressed under vegetative growth conditions (15). However, the replacement of the endogenous gneY promoter with an isopropyl-␤-D-thiogalactopyranoside (IPTG)-inducible spac promoter supports growth of the B. anthracis gneZ mutant (14). Removal of the gneY inducer causes defects in S-layer assembly, suggesting that a UDP-GlcNAc 2-epimerase indeed supplies ManNAc for SCWP synthesis (14).…”

mentioning

confidence: 99%

See 4 more Smart Citations

Bacillus anthracis tagO Is Required for Vegetative Growth and Secondary Cell Wall Polysaccharide Synthesis

et al. 2015

Self Cite

View full text Add to dashboard Cite

Bacillus anthracis elaborates a linear secondary cell wall polysaccharide (SCWP) that retains surface (S)-layer and associated proteins via their S-layer homology (SLH) domains. The SCWP is comprised of trisaccharide repeats [¡4)-␤-ManNAc-(1¡4)-␤-GlcNAc-(1¡6)-␣-GlcNAc-(1¡]and tethered via acid-labile phosphodiester bonds to peptidoglycan. Earlier work identified UDP-GlcNAc 2-epimerases GneY (BAS5048) and GneZ (BAS5117), which act as catalysts of ManNAc synthesis, as well as a polysaccharide deacetylase (BAS5051), as factors contributing to SCWP synthesis. Here, we show that tagO (BAS5050), which encodes a UDP-N-acetylglucosamine:undecaprenyl-P N-acetylglucosaminyl 1-P transferase, the enzyme that initiates the synthesis of murein linkage units, is required for B. anthracis SCWP synthesis and S-layer assembly. Similar to gneY-gneZ mutants, B. anthracis strains lacking tagO cannot maintain cell shape or support vegetative growth. In contrast, mutations in BAS5051 do not affect B. anthracis cell shape, vegetative growth, SCWP synthesis, or S-layer assembly. These data suggest that TagO-mediated murein linkage unit assembly supports SCWP synthesis and attachment to the peptidoglycan via acid-labile phosphodiester bonds. Further, B. anthracis variants unable to synthesize SCWP trisaccharide repeats cannot sustain cell shape and vegetative growth. IMPORTANCEBacillus anthracis elaborates an SCWP to support vegetative growth and envelope assembly. Here, we show that some, but not all, SCWP synthesis is dependent on tagO-derived murein linkage units and subsequent attachment of SCWP to peptidoglycan. The data implicate secondary polymer modifications of peptidoglycan and subcellular distributions as a key feature of the cell cycle in Gram-positive bacteria and establish foundations for work on the molecular functions of the SCWP and on inhibitors with antibiotic attributes.T he cell wall envelope of Bacillus anthracis, the causative agent of anthrax, is comprised of peptidoglycan and its attached secondary cell wall polysaccharide (SCWP) (1). The SCWP retains two surface (S)-layer proteins, surface array protein (Sap) and extractable antigen 1 (EA1) (2), as well as 22 S-layer-associated proteins whose S-layer homology (SLH) domains associate with ketal-pyruvylated SCWP (3, 4). Unlike nonpathogenic Bacillus spp., for example, Bacillus subtilis and Bacillus cereus AHU1030, B. anthracis does not synthesize wall teichoic acid (WTA) (5, 6). Nevertheless, B. anthracis expresses functional tagO and tagA genes, whose products provide for the synthesis of murein linkage units [P-GlcNAc-(4¡1)-␤-ManNAc-R] that are phosphodiester linked to the C 6 -hydroxyl of N-acetylmuramic acid in the repeating disaccharide of peptidoglycan [MurNAc(P-GlcNAc-ManNAc-R)-GlcNAc] (4). In B. subtilis, -R represents wall teichoic acid, i.e., either polyglycerol-phosphate or polyribitol-phosphate (7). Here, we test the hypothesis that in B. anthracis the SCWP is attached via the murine linkage unit and that the tagO gene is required for vegetati...

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 3 more Smart Citations

Bacillus anthracis tagO Is Required for Vegetative Growth and Secondary Cell Wall Polysaccharide Synthesis

et al. 2015

Self Cite

View full text Add to dashboard Cite

show abstract

Biosynthesis and growth

Kim

Gadd

2019

Prokaryotic Metabolism and Physiology

View full text Add to dashboard Cite

Distinct Pathways Carry Out α and β Galactosylation of Secondary Cell Wall Polysaccharide in Bacillus anthracis

Château

Τοματσίδου

et al. 2020

J Bacteriol

Self Cite

View full text Add to dashboard Cite

ABSTRACT Bacillus anthracis, the causative agent of anthrax disease, elaborates a secondary cell wall polysaccharide (SCWP) that is required for the retention of surface layer (S-layer) and S-layer homology (SLH) domain proteins. Genetic disruption of the SCWP biosynthetic pathway impairs growth and cell division. B. anthracis SCWP is comprised of trisaccharide repeats composed of one ManNAc and two GlcNAc residues with O-3–α-Gal and O-4–β-Gal substitutions. UDP-Gal, synthesized by GalE1, is the substrate of galactosyltransferases that modify the SCWP repeat. Here, we show that the gtsE gene, which encodes a predicted glycosyltransferase with a GT-A fold, is required for O-4–β-Gal modification of trisaccharide repeats. We identify a DXD motif critical for GtsE activity. Three distinct genes, gtsA, gtsB, and gtsC, are required for O-3–α-Gal modification of trisaccharide repeats. Based on the similarity with other three-component glycosyltransferase systems, we propose that GtsA transfers Gal from cytosolic UDP-Gal to undecaprenyl phosphate (C55-P), GtsB flips the C55-P-Gal intermediate to the trans side of the membrane, and GtsC transfers Gal onto trisaccharide repeats. The deletion of galE1 does not affect growth in vitro, suggesting that galactosyl modifications are dispensable for the function of SCWP. The deletion of gtsA, gtsB, or gtsC leads to a loss of viability, yet gtsA and gtsC can be deleted in strains lacking galE1 or gtsE. We propose that the loss of viability is caused by the accumulation of undecaprenol-bound precursors and present an updated model for SCWP assembly in B. anthracis to account for the galactosylation of repeat units. IMPORTANCE Peptidoglycan is a conserved extracellular macromolecule that protects bacterial cells from turgor pressure. Peptidoglycan of Gram-positive bacteria serves as a scaffold for the attachment of polymers that provide defined bacterial interactions with their environment. One such polymer, B. anthracis SCWP, is pyruvylated at its distal end to serve as a receptor for secreted proteins bearing the S-layer homology domain. Repeat units of SCWP carry three galactoses in B. anthracis. Glycosylation is a recurring theme in nature and often represents a means to mask or alter conserved molecular signatures from intruders such as bacteriophages. Several glycosyltransferase families have been described based on bioinformatics prediction, but few have been studied. Here, we describe the glycosyltransferases that mediate the galactosylation of B. anthracis SCWP.

show abstract

GneZ, a UDP-GlcNAc 2-Epimerase, Is Required for S-Layer Assembly and Vegetative Growth of Bacillus anthracis

Cited by 13 publications

References 41 publications

Bacillus anthracis tagO Is Required for Vegetative Growth and Secondary Cell Wall Polysaccharide Synthesis

Bacillus anthracis tagO Is Required for Vegetative Growth and Secondary Cell Wall Polysaccharide Synthesis

Biosynthesis and growth

Distinct Pathways Carry Out α and β Galactosylation of Secondary Cell Wall Polysaccharide in Bacillus anthracis

Contact Info

Product

Resources

About