Glyphosate resistance in <i>Ambrosia trifida</i>: Part 1. Novel rapid cell death response to glyphosate

Horn, Christopher R Van; Moretti, Marcelo L.; Robertson, Renae R; Segobye, Kabelo; Weller, Stephen C.; Young, Bryan G.; Johnson, William G.; Schulz, Burkhard; Green, Amanda C.; Jeffery, Taylor; Lespérance, Mackenzie A; Tardif, François J.; Sikkema, Peter H.; Hall, J. Christopher; McLean, Michael D.; Lawton, Mark B.; Sammons, R. Douglas; Wang, Dafu; Westra, Philip; Gaines, Todd A.

doi:10.1002/ps.4567

Cited by 50 publications

(82 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…DNA quality and quantification were measured using a NanoDrop spectrophotometer, and DNA integrity was evaluated by running samples through 1% agarose gel. Primers were designed for EPSPS and isocitrate dehydrogenase (IDH) as an internal standard: EPSPS_F (5′‐ ACATGCTTGGGGCTCTAAGAA‐3′), EPSPS_R (5′‐ TTGAATTACCACCAGCAGCGGT‐3′), IDH_F: (5′‐GCTTTGCATTGTCATCCAACTT‐3′), and IDH_R: (5′‐TGGTTCTCTTGGATTGATGACC‐3′) . Genomic DNA (10 ng) was amplified using quantitative real‐time PCR with 25 μL total volume under the following conditions: 10 min at 95 °C, 40 cycles of 95 °C for 20 s and 57 °C for 1 min.…”

Section: Methodsmentioning

confidence: 99%

“…After completing these cycles, temperature was increased 0.5 °C every 5 s from 60 °C to 95 °C to obtain a melting curve. From calculated threshold cycles ( C t ), relative EPSPS copy number was expressed as 2 Δ C t where:

Δ C_{normalt} = C_{normalt} IDH - C_{normalt} EPSPS

…”

Section: Methodsmentioning

confidence: 99%

“…Genomic DNA was extracted using the Qiagen DNeasy plant DNA extraction kit as described above. The entire EPSPS gene was amplified using primers designed based on previous transcriptome data: F‐CCACACCTACTACTACGTGTTCTTGG and R‐CCCTACCTTAGCTTTGCTATTGGTG . The PCR was performed using a PCR kit (EconoTaq, Lucigen, Middleton, WI, USA) with 12.5 μL of 10 X Reaction Buffer, 2.0 μL of the primer mix (0.2 μM of final concentration of each primer, forward and reverse), 9.5 μL of ultrapure water and 1.0 μL of DNA template (10 ng μL −1 ); this provided a final reaction volume of 25 μL.…”

Section: Methodsmentioning

confidence: 99%

“…Among confirmed glyphosate‐resistant A. trifida populations, two distinct phenotypes following exposure to glyphosate have been observed . The more common has been a non‐rapid response (NRR) phenotype for which growth slows within 1 to 2 weeks after treatment (WAT) and meristematic tissue becomes chlorotic.…”

Section: Introductionmentioning

confidence: 99%

“…Similar to RR A. trifida , EPSPS target site inhibition, EPSPS sequence, EPSPS copy number, and EPSPS quantity or activity did not explain glyphosate resistance in several accessions of NRR A. trifida . The Wisconsin R phenotype was included in some of these studies which found that glyphosate resistance in the Wisconsin R phenotype was not associated with EPSPS inhibition, mutations in a partial EPSPS sequence, or increased EPSPS copy number; however, other potential resistance mechanisms such as differential glyphosate absorption, translocation, or metabolism were not investigated, nor were mutations to the full‐length EPSPS sequence. As noted above for RR phenotypes, resistance in some NRR phenotypes has not been found to be associated with vacuole sequestration of glyphosate …”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Physiological and molecular analysis of glyphosate resistance in non‐rapid response Ambrosia trifida from Wisconsin

Wilson

Takano

Horn

et al. 2019

Pest Management Science

Self Cite

View full text Add to dashboard Cite

BACKGROUND We previously identified a glyphosate‐resistant A. trifida phenotype from Wisconsin USA that showed a non‐rapid response to glyphosate. The mechanism of glyphosate resistance in this phenotype has yet to be elucidated. We conducted experiments to investigate non‐target‐site resistance and target‐site resistance mechanisms. The roles of glyphosate absorption, translocation, and metabolism in resistance of this phenotype have not been reported previously, nor have EPSPS protein abundance or mutations to the full‐length sequence of EPSPS. RESULTS Whole‐plant dose–response results confirmed a 6.5‐level of glyphosate resistance for the resistant (R) phenotype compared to a susceptible (S) phenotype. Absorption and translocation of 14C‐glyphosate were similar between R and S phenotypes over 72 h. Glyphosate and AMPA concentrations in leaf tissue did not differ between R and S phenotypes over 96 h. In vivo shikimate leaf disc assays confirmed that glyphosate EC50 values were 4.6‐ to 5.4‐fold greater for the R than S phenotype. Shikimate accumulation was similar between phenotypes at high glyphosate concentrations (>1000 μM), suggesting that glyphosate entered chloroplasts and inhibited EPSPS. This finding was supported by results showing that EPSPS copy number and EPSPS protein abundance did not differ between R and S phenotypes, nor did EPSPS sequence at Gly101, Thr102, and Pro106 positions. Comparison of full‐length EPSPS sequences found five nonsynonymous polymorphisms that differed between R and S phenotypes. However, their locations were distant from the glyphosate target site and, therefore, not likely to affect enzyme‐glyphosate interaction. CONCLUSION The results suggest that a novel mechanism confers glyphosate resistance in this A. trifida phenotype. © 2019 Society of Chemical Industry

show abstract

Section: Methodsmentioning

confidence: 99%

Δ C_{normalt} = C_{normalt} IDH - C_{normalt} EPSPS

…”

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Physiological and molecular analysis of glyphosate resistance in non‐rapid response Ambrosia trifida from Wisconsin

Wilson

Takano

Horn

et al. 2019

Pest Management Science

Self Cite

View full text Add to dashboard Cite

show abstract

Evolution of weedy giant ragweed (Ambrosia trifida): Multiple origins and gene expression variability facilitates weediness

Gschwend

Hovick

et al. 2022

Ecology and Evolution

View full text Add to dashboard Cite

Agricultural weeds may originate from wild populations, but the origination patterns and genetics underlying this transition remain largely unknown. Analysis of weedy‐wild paired populations from independent locations may provide evidence to identify key genetic variation contributing to this adaptive shift. We performed genetic variation and expression analyses on transcriptome data from 67 giant ragweed samples collected from different locations in Ohio, Iowa, and Minnesota and found geographically separated weedy populations likely originated independently from their adjacent wild populations, but subsequent spreading of weedy populations also occurred locally. By using eight closely related weedy‐wild paired populations, we identified thousands of unique transcripts in weedy populations that reflect shared or specific functions corresponding, respectively, to both convergently evolved and population‐specific weediness processes. In addition, differential expression of specific groups of genes was detected between weedy and wild giant ragweed populations using gene expression diversity and gene co‐expression network analyses. Our study suggests an integrated route of weedy giant ragweed origination, consisting of independent origination combined with the subsequent spreading of certain weedy populations, and provides several lines of evidence to support the hypothesis that gene expression variability plays a key role in the evolution of weedy species.

show abstract

Glyphosate resistance in Ambrosia trifida: Part 2. Rapid response physiology and non‐target‐site resistance

Moretti

Horn

Robertson

et al. 2017

Pest Management Science

Self Cite

View full text Add to dashboard Cite

The GR RR mechanism of resistance is not associated with vacuole sequestration of glyphosate, and the observed reduced translocation is likely a consequence of rapid tissue death. Rapid cell death was inhibited by exogenous application of aromatic amino acids phenylalanine and tyrosine. The mechanism by which these amino acids inhibit rapid cell death in the GR RR phenotype remains unknown, and it could involve glyphosate phytotoxicity or other agents generating reactive oxygen species. Implications of these findings are discussed. The GR RR mechanism is distinct from the currently described glyphosate TSR or NTSR mechanisms in other species. © 2017 Society of Chemical Industry.

show abstract

Glyphosate resistance in Ambrosia trifida: Part 1. Novel rapid cell death response to glyphosate

Abstract: These encompassing results suggest that resistance to glyphosate in these GR RR A. trifida accessions is not conferred by a target-site resistance mechanism. © 2017 Society of Chemical Industry.

Cited by 50 publications

References 24 publications

Physiological and molecular analysis of glyphosate resistance in non‐rapid response Ambrosia trifida from Wisconsin

Physiological and molecular analysis of glyphosate resistance in non‐rapid response Ambrosia trifida from Wisconsin

Evolution of weedy giant ragweed (Ambrosia trifida): Multiple origins and gene expression variability facilitates weediness

Glyphosate resistance in Ambrosia trifida: Part 2. Rapid response physiology and non‐target‐site resistance

Contact Info

Product

Resources

About