Glycogen Synthase Kinase 3β and Extracellular Signal-Regulated Kinase Inactivate Heat Shock Transcription Factor 1 by Facilitating the Disappearance of Transcriptionally Active Granules after Heat Shock

Abstract

Heat shock transcription factor 1 (HSF-1) activates the transcription of heat shock genes in eukaryotes. Under normal physiological growth conditions, HSF-1 is a monomer. Its transcriptional activity is repressed by constitutive phosphorylation. Upon activation, HSF-1 forms trimers, acquires DNA binding activity, increases transcriptional activity, and appears as punctate granules in the nucleus. In this study, using bromouridine incorporation and confocal laser microscopy, we demonstrated that newly synthesized pre-mRNAs colocalize to the HSF-1 punctate granules after heat shock, suggesting that these granules are sites of transcription. We further present evidence that glycogen synthase kinase 3␤ (GSK-3␤) and extracellular signal-regulated kinase mitogen-activated protein kinase (ERK MAPK) participate in the down regulation of HSF-1 transcriptional activity. Transient increases in the expression of GSK-3␤ facilitate the disappearance of HSF-1 punctate granules and reduce hsp-70 transcription after heat shock. We have also shown that ERK is the priming kinase for GSK-3␤. Taken together, these results indicate that GSK-3␤ and ERK MAPK facilitate the inactivation of activated HSF-1 after heat shock by dispersing HSF-1 from the sites of transcription.The nuclear translocation, DNA binding, and transcriptional activities of most mammalian transcription factors are regulated by phosphorylation. In many cases, multiple protein kinases can act on a single transcription factor (reviewed in reference 27). Heat shock transcription factor 1 (HSF-1) is subject to complex regulation by phosphorylation. HSF-1 binds to conserved regulatory sequences known as heat shock elements (HSEs) and controls the expression of heat shock proteins in response to chemical, environmental, and physiological stresses (1,36,42,61,68,74).Under normal physiological growth conditions, mammalian HSF-1 exists in a latent, monomeric form (4,55,66,69); is constitutively phosphorylated (4, 10, 43, 55); and is distributed in both the cytoplasm and nucleus. The functional role of phosphorylation in HSF-1 regulation is unclear. Strong evidence suggests that constitutive phosphorylation of HSF-1 negatively regulates HSF-1 activity (9, 31, 32, 43). Upon heat shock, the latent form of HSF-1 is translocated into the nucleus, forms trimers, is hyperphosphorylated, and appears as punctate granules (4,44,51,55). The function of hyperphosphorylation (4,10,46,55) or the role of HSF-1 punctate granules is not known. Punctate granules have been suggested to be important for some activity of HSF-1, perhaps its DNA binding activity (58).Phosphorylated forms of HSF-1 have been extensively studied by phosphopeptide mapping as well as mutational analysis (30)(31)(32)71). The data suggest that HSF-1 is phosphorylated on multiple serine residues and, perhaps, a threonine residue. Constitutive phosphorylation of serine 307, which is located distal to the transcriptional activation domain, negatively regulates HSF-1 function, since mutation of serine 307 to alanine (31, 71)...

GSK-3β inhibition protects mesothelial cells during experimental peritoneal dialysis through upregulation of the heat shock response

“…One of the major pathways influenced by GSK-3β is the cytoprotective HSR (Kline and Morimoto 1997;He et al 1998). The HSPs, which are the effector proteins of the HSR, are molecular chaperones playing an important role in the establishment of proper protein conformation and prevention of unwanted protein aggregation.…”

“…As GSK-3β is known to negatively regulate HSF-1-dependent HSR, GSK-3β activation might suppress and GSK-3β inhibition might enhance activation of the mesothelial HSR (He et al 1998;Chu et al 1998;Rowe et al 2007).…”

Ha-rasval12 induces HSP70b transcription via the HSE/HSF1 system, but HSP70b expression is suppressed in Ha-rasval12-transformed cells

“…To construct the pHSE Luciferase reporter, the following primers were used (He et al, 1998): HSE F 5 0 tcgagtc gacggatccgagcgcctcgaatgttctagaaaaggc 3 0 , HSE R 5 0 tcgagcctt ttctagaacattcgaggcgctcggatccgtcgac 3 0 . Double strand oligo was self-ligated and X3 repeats were selected for ligation with a pTAL reporter (promega) cut with XhoI.…”

Invited Review: Interplay between molecular chaperones and signaling pathways in survival of heat shock

“…For example, heat-induced activation of Akt increased HSF1 activity, possibly through inhibition of glycogen synthase kinase-3␤ (3), a negative regulator of HSF1 (6,62). On the other hand, heat shock-induced activation of ERK and JNK decreased HSF1 activity through phosphorylation at distinct sites (6,9,22). Therefore, it seems that regulation of HSP transcription by stress-activated signaling pathways may be an important factor affecting balance between death and survival programs.…”