Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice

Caldow, Marissa K.; Ham, Daniel J.; Godeassi, Daniel P.; Chee, Annabel; Lynch, Gordon S.; Koopman, René

doi:10.1016/j.clnu.2015.08.013

Cited by 28 publications

(33 citation statements)

References 31 publications

(31 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In addition, dietary supplementation of 1.0 and 2.0% glycine resulted in lower mRNA expression of MuRF1 in gastrocnemius muscle than the LPS control, and even lower mRNA expression of MAFbx in gastrocnemius muscle than the saline control, suggesting glycine inhibited the expression of muscle atrophy-associated genes and thus inhibited protein degradation. Similar to our data, Caldow et al (5) reported that glycine administration during calorie restriction protected against further muscle loss in obese mice. In addition, Ham et al (17) showed that glycine supplementation alleviated skeletal muscle wasting and reduced the expression of genes associated with muscle protein breakdown (MuRF1, MAFbx, LC3B, and BNIP3) in a mouse model of cancer cachexia.…”

Section: Discussionsupporting

confidence: 82%

“…Glycine has multiple physiological functions in animals (53). Of particular interest, increasing evidence has shown that glycine exerts beneficial effects in several models of muscle atrophy, such as cancer cachexia (17) and calorie restriction (5). Based on this, we explored the effect of glycine on the markers of muscle atrophy after a 4-h Escherichia coli LPS challenge in a piglet model.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Glycine enhances muscle protein mass associated with maintaining Akt-mTOR-FOXO1 signaling and suppressing TLR4 and NOD2 signaling in piglets challenged with LPS

Liu

Wang

et al. 2016

American Journal of Physiology-Regulatory, Integrative and Comp

View full text Add to dashboard Cite

show abstract

Section: Discussionsupporting

confidence: 82%

Section: Discussionmentioning

confidence: 99%

Glycine enhances muscle protein mass associated with maintaining Akt-mTOR-FOXO1 signaling and suppressing TLR4 and NOD2 signaling in piglets challenged with LPS

Liu

Wang

et al. 2016

American Journal of Physiology-Regulatory, Integrative and Comp

View full text Add to dashboard Cite

show abstract

“…Glyine or alanine (1 g/kg) was administered ip 30 min prior to LPS administration. Based on our observations of a consistent lack of effect of L-alanine supplementation on skeletal muscle across multiple in vitro (24,26) and in vivo (6,27,28) studies, we used L-alanine as our amino acid control. Groups were matched for body mass, and food was removed 1 h before the administration of LPS (or saline in the control group).…”

Section: Animalsmentioning

confidence: 99%

“…Quadriceps muscle samples (ϳ20 mg) were homogenized using ice-cold lysis buffer (20 mM Tris·HCl, 5 mM ethylenediamine-tetraacetic acid, 10 mM Na-pyrophosphate, 100 mM NaF, 2 mM Na 3VO4, and 1 mM PMSF) containing protease and phosphatase inhibitors (Sigma-Aldrich, Castle Hill, New South Wales, Australia). Protein (30 g) was separated by 4 -15% SDS-PAGE using Criterion TGX Stain-Free Precast Gels (Bio-Rad Laboratories , suppressor of cytokine signaling 3 (SOCS3; clone 1B2; Millipore, Bayswater, Victoria, Australia), and IL-6 (GTX27737; GeneTex, Irvine, CA) were performed as described previously (6). For 4-hydroxynonenal (4HNE) (ab46545; Abcam, Melbourne, Victoria, Australia), gels were transferred to a nitrocellulose membrane, blocked in 5% milk-TBST, and incubated overnight at 4°C in 5% milk-TBST containing 4HNE (1:1,000).…”

Section: Animalsmentioning

confidence: 99%

Glycine restores the anabolic response to leucine in a mouse model of acute inflammation

Ham

Caldow

Chhen

et al. 2016

American Journal of Physiology-Endocrinology and Metabolism

Self Cite

View full text Add to dashboard Cite

Amino acids, especially leucine, potently stimulate protein synthesis and reduce protein breakdown in healthy skeletal muscle and as a result have received considerable attention as potential treatments for muscle wasting. However, the normal anabolic response to amino acids is impaired during muscle-wasting conditions. Although the exact mechanisms of this anabolic resistance are unclear, inflammation and ROS are believed to play a central role. The nonessential amino acid glycine has anti-inflammatory and antioxidant properties and preserves muscle mass in calorie-restricted and tumor-bearing mice. We hypothesized that glycine would restore the normal muscle anabolic response to amino acids under inflammatory conditions. Relative rates of basal and leucine-stimulated protein synthesis were measured using SUnSET methodology 4 h after an injection of 1 mg/kg lipopolysaccharide (LPS). Whereas leucine failed to stimulate muscle protein synthesis in LPS-treated mice pretreated with l-alanine (isonitrogenous control), leucine robustly stimulated protein synthesis (+51%) in mice pretreated with 1 g/kg glycine. The improvement in leucine-stimulated protein synthesis was accompanied by a higher phosphorylation status of mTOR, S6, and 4E-BP1 compared with l-alanine-treated controls. Despite its known anti-inflammatory action in inflammatory cells, glycine did not alter the skeletal muscle inflammatory response to LPS in vivo or in vitro but markedly reduced DHE staining intensity, a marker of oxidative stress, in muscle cross-sections and attenuated LPS-induced wasting in C2C12 myotubes. Our observations in male C57BL/6 mice suggest that glycine may represent a promising nutritional intervention for the attenuation of skeletal muscle wasting.

show abstract

“…Total RNA was extracted from the QUAD muscles. The Bio-Rad CFX384 PCR system (Bio-Rad Laboratories) was used to perform qPCR as described previously [3,7]. Gene sequences were obtained from GenBank to design primers which are listed here (Socs1 F: CTTAACCCGGTACTCCGTGA,…”

Section: Rna Extraction and Qpcrmentioning

confidence: 99%

Muscle-specific deletion of SOCS3 does not reduce the anabolic response to leucine in a mouse model of acute inflammation

et al. 2017

View full text Add to dashboard Cite

Excessive inflammation reduces skeletal muscle protein synthesis leading to wasting and weakness. The janus kinase/signal transducers and activators of transcription-3 (JAK/STAT3) pathway is important for the regulation of inflammatory signaling. As such, suppressor of cytokine signaling-3 (SOCS3), the negative regulator of JAK/STAT signaling, is thought to be important in the control of muscle homeostasis. We hypothesized that muscle-specific deletion of SOCS3 would impair the anabolic response to leucine during an inflammatory insult. Twelve week old (n=8 per group) SOCS3 muscle-specific knockout mice (SOCS3-MKO) and littermate controls (WT) were injected with lipopolysaccharide (LPS, 1 mg/kg) or saline and were studied during fasted conditions or after receiving 0.5 g/kg leucine 3 h after the injection of LPS. Markers of inflammation, anabolic signaling, and protein synthesis were measured 4 h after LPS injection. LPS injection robustly increased mRNA expression of inflammatory molecules (Socs3, Socs1, Il-6, Ccl2, Tnfα and Cd68). In muscles from SOCS3-MKO mice, the Socs3 mRNA response to LPS was significantly blunted (~6-fold) while STAT3 Tyr705 phosphorylation was exacerbated (18-fold). Leucine administration increased protein synthesis in both WT (~1.6-fold) and SOCS3-MKO mice (~1.5-fold) compared to basal levels. LPS administration blunted this effect, but there were no differences between WT and SOCS3-MKO mice. Muscle-specific SOCS3 deletion did not alter the response of AKT, mTOR, S6 or 4EBP1 under any treatment conditions. Therefore, SOCS3 does not appear to mediate the early inflammatory or leucine-induced changes in protein synthesis in skeletal muscle. Highlights  SOCS3 deletion in skeletal muscle does not alter LPS-induced inflammation.  SOCS3 does not mediate the anabolic response to leucine in skeletal muscle.  Leucine augments the LPS-induced expression of IL-6 and STAT3 phosphorylation.

show abstract

Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice

Cited by 28 publications

References 31 publications

Glycine enhances muscle protein mass associated with maintaining Akt-mTOR-FOXO1 signaling and suppressing TLR4 and NOD2 signaling in piglets challenged with LPS

Glycine enhances muscle protein mass associated with maintaining Akt-mTOR-FOXO1 signaling and suppressing TLR4 and NOD2 signaling in piglets challenged with LPS

Glycine restores the anabolic response to leucine in a mouse model of acute inflammation

Muscle-specific deletion of SOCS3 does not reduce the anabolic response to leucine in a mouse model of acute inflammation

Contact Info

Product

Resources

About