Glugea sp. infecting Sardinella aurita in Algeria

Glugea plecoglossi (Strickland, 1911) infection in wild Sardinella aurita (Valenciennes, 1847) along the Campania coasts, in southern Italy

“…DNA was extracted from xenomas of sardines ( n = 49) with QIAamp DNA mini KIT (QIAGEN) and screened for Glugea spp. by PCR targeting the 18S rRNA gene (Abdel‐Baki et al., 2015; Ramdani et al., 2022). PCRs were performed in a total volume of 25 μL containing HotStar HiFidelity PCR kit, 0.5 μM of each primer and 5 μL DNA.…”

“…PCRs were performed in a total volume of 25 μL containing HotStar HiFidelity PCR kit, 0.5 μM of each primer and 5 μL DNA. Primers were V1F (5′‐CACCAGGTTGATTCTGCTGAC‐3′) and 1942R (5′‐GGTTACCTTGTTACGACTT‐3′) (Ramdani et al., 2022). Amplification conditions had initial denaturation at 95°C for 15 min, followed by 35 cycles of denaturation at 95°C for 40 s, annealing at 53°C for 40 s and extension at 72°C for 1 min and final extension at 72°C for 10 min.…”

“…PCRs were performed in a total volume of 25 μL containing HotStar HiFidelity PCR kit, 0.5 μM of each primer and 5 μL DNA. Primers were V1F (5′-CACCAGGTTGATTCTGCTGAC-3′) and 1942R (5′-GGTTACCTTGTTACGACTT-3′) (Ramdani et al, 2022).…”

“…It is reported that Glugea spp. infect the intestinal submucosal cells of fish, forming xenomas (Kent et al., 2014; Mansour et al., 2016; Ramdani et al., 2022).…”