Glucose-regulated Protein 78 Is an Intracellular Antiviral Factor against Hepatitis B Virus

Ma, Yan; Yu, Jun; Chan, Henry Lik‐Yuen; Chen, Yangchao; Wang, Hua; Chen, Ying; Chan, Cerise Yuen‐Ki; Go, Minnie Y.Y.; Tsai, Sau-Na; Ngai, Sai-Ming; To, Ka‐Fai; Tong, Joanna H.M.; He, Qing‐Yu; Sung, Joseph J.Y.; Kung, Hsiang‐Fu; Chen, Cheng; He, Ming‐Liang

doi:10.1074/mcp.m900180-mcp200

Cited by 50 publications

(68 citation statements)

References 36 publications

(31 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…EV71-conditioned medium was collected when RD cells were infected with EV71 at an MOI of 10 for 9 h. IFN-␤-specific antibody (ab6979; Abcam) was used for neutralization at 2.7 g/ml. HEK293T cells were cotransfected with pAAV-EGFP (where EGFP is enhanced green fluorescent protein) and a plasmid expressing viral proteins (ratio, 1:5) by using Lipofectamine 2000 (Invitrogen) as described previously (43). The transfection efficiency was measured under a fluorescence microscope.…”

Section: Methodsmentioning

confidence: 99%

“…Fluorescence signals were collected by the machine during the extension phase of each PCR cycle. The threshold cycle (C T ) value was normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), EGFP, and each viral protein (43). The qRT-PCR was performed by using the following primer pairs: for human IFN-␤, GACCAA CAAGTGTCTCCTCCAAA and GAACTGCTGCAGCTGCTTAATC; ISG15, ATGGGCTGGGACCTGACG and GCCAATCTTCTGGGTGAT CTG; ISG56, TCCCCTAAGGCAGGCTGTC and GACATGTTGGCTAG AGCTTCTTC; MxA, GCTTGCTTTCACAGATGTTTCG and AAGGGA TGTGGCTGGAGATG; OAS1, TCCACCTGCTTCACAGAACTACA and TGGGCTGTGTTGAAATGTGTTT; GAPDH, GATTCCACCCATG GCAAATTCCA and TGGTGATGGGATTTCCATTGATGA.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Enterovirus 71 Disrupts Interferon Signaling by Reducing the Level of Interferon Receptor 1

Liu

Zhao

et al. 2012

J Virol

Self Cite

133

130

View full text Add to dashboard Cite

The recent outbreak of enterovirus 71 (EV71) infected millions of children and caused over 1,000 deaths. To date, neither an effective vaccine nor antiviral treatment is available for EV71 infection. Interferons (IFNs) have been successfully applied to treat patients with hepatitis B and C viral infections for decades but have failed to treat EV71 infections. Here, we provide the evidence that EV71 antagonizes type I IFN signaling by reducing the level of interferon receptor 1 (IFNAR1). We show that the host cells could sense EV71 infection and stimulate IFN-␤ production. However, the induction of downstream IFN-stimulated genes is inhibited by EV71. Also, only a slight interferon response and antiviral effects could be detected in cells treated with recombinant type I IFNs after EV71 infection. Further studies reveal that EV71 blocks the IFN-mediated phosphorylation of STAT1, STAT2, Jak1, and Tyk2 by reducing IFNAR1. Finally, we identified the 2A protease encoded by EV71 as an antagonist of IFNs and show that the protease activity is required for reducing IFNAR1 levels. Taken together, our study for the first time uncovers a mechanism used by EV71 to antagonize type I IFN signaling and provides new targets for future antiviral strategies. E nterovirus 71 (EV71) is a typical positive-strand RNA virus which belongs to the Picornaviridae family (44). The genome of EV71 is approximately 7.5 kb in length and contains a single open reading frame encoding a polyprotein precursor. This polyprotein is cleaved by two viral proteases, 2Apro and 3C pro , to form four structural proteins (VP1, VP2, VP3, and VP4) and seven nonstructural proteins (2A, 2B, 2C, 3A, 3B, 3C, and 3D) (39). EV71 infection was a major cause of outbreaks of hand, foot, and mouth disease (HFMD) in infants and young children (19,22). As a typical neurotropic virus, EV71 has a propensity to cause neurological disease during acute infection and may lead to permanent paralysis and even death (1,42,45). The outbreaks and severity of EV71 infection have been frequently reported worldwide (60), and recently EV71 has become a major threat to public health in China (56). The Chinese government reported that there were ϳ1,770,000 cases of HFMD and herpangina with over 900 deaths in 2010 (http://www.moh.gov.cn/publicfiles/business/htmlfiles/zwgkzt /pyq/list.htm). However, to date, no effective vaccine or therapy can be applied to prevent or treat EV71 infection.Type I interferon (IFN), as the first line of host immune response, is critical in mediating antiviral defense. The host recognizes viral invasion and activates the type I IFN response through the recognition of pathogen-associated molecular patterns (PAMPs) by patternrecognition receptors (PRRs) (61). Binding with the corresponding receptors, IFN receptor 1 (IFNAR1) and IFNAR2 (11, 50), the secreted IFNs activate the Janus kinases Jak1 and Tyk2 and then phosphorylate signal transducers and activators of transcription STAT1 and STAT2 (23). The phosphorylated STAT1 and STAT2 form heterodimers and bind with...

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Enterovirus 71 Disrupts Interferon Signaling by Reducing the Level of Interferon Receptor 1

Liu

Zhao

et al. 2012

J Virol

Self Cite

133

130

View full text Add to dashboard Cite

show abstract

“…Huang et al, report that HSPA5 siRNA decreases the amount of HBV DNA detected in the supernatants of infected cell cultures (75). Alternatively, Ma et al, describe HSPA5 as a potent antiviral protein in the context of HBV infection (76). In that report, siRNA-medi- Table I, cell localization and protein interaction information was examined using Ingenuity Pathways Analysis software.…”

Section: Filovirion-associated Host Proteinsmentioning

confidence: 99%

Identification of Essential Filovirion-associated Host Factors by Serial Proteomic Analysis and RNAi Screen

Spurgers

Alefantis

Peyser

et al. 2010

Molecular & Cellular Proteomics

View full text Add to dashboard Cite

An assessment of the total protein composition of filovirus (ebolavirus and marburgvirus) virions is currently lacking. In this study, liquid chromatography-linked tandem mass spectrometry of purified ebola and marburg virions was performed to identify associated cellular proteins. Host proteins involved in cell adhesion, cytoskeleton, cell signaling, intracellular trafficking, membrane organization, and chaperones were identified. Significant overlap exists between this data set and proteomic studies of disparate viruses, including HIV-1 and influenza A, generated in multiple cell types. However, the great majority of proteins identified here have not been previously described to be incorporated within filovirus particles. Host proteins identified by liquid chromatography-linked tandem mass spectrometry could lack biological relevance because they represent protein contaminants in the virus preparation, or because they are incorporated within virions by chance. These issues were addressed using siRNA library-mediated gene knockdown (targeting each identified virion-associated host protein), followed by filovirus infection. Knockdown of several host proteins (e.g. HSPA5 and RPL18) significantly interfered with ebolavirus and marburgvirus infection, suggesting specific and relevant virion incorporation. Notably, select siRNAs inhibited ebolavirus, but enhanced marburgvirus infection, suggesting important differences between the two viruses. The proteomic analysis presented here contributes to a greater understanding of filovirus biology and potentially identifies host factors that can be targeted for antiviral drug development. Molecular & Cellular Proteomics 9: 2690 -2703, 2010.

show abstract

“…This method has been applied to the HepAD38 and HepG2.2.15 cell lines, both of which originated in an HCC cell line named HepG2 and were integrated with a length of HBV genome more than one unit [3]. These investigations gave an insight into the characterization and identification of unique proteome profiles linked to HBV infection in immortalized hepatocytes [4, 5]. Although valuable knowledge on HBV activities during infection were provided, the utilized expression techniques resorted to “bulk” homogenates of cell lines, and did not provide preferential enrichment for the secreted proteins [6], which are expected to involve the most promising extra-cellular regulatory factors for HBV replication.…”

Section: Introductionmentioning

confidence: 99%

Proteomics Based Identification of Autotaxin As An Anti-Hepatitis B Virus Factor and a Promoter of Hepatoma Cell Invasion and Migration

She¹,

Yang²,

Hu³

et al. 2018

Cell Physiol Biochem

View full text Add to dashboard Cite

Background/Aims: Hepatitis B virus (HBV) infection is a major cause of cirrhosis and hepatocellular carcinoma. Therefore, we aimed to obtain further information on HBV pathogenesis, and to search for novel putative molecules for anti-HBV therapy. Methods: We utilized Isobaric Tags for Relative and Absolute Quantitation (iTRAQ) to identify the secretory proteins that are differentially expressed in the HBV DNA-transfected HepG2.2.15 cell line and its parental HepG2 cell line. Immunohistochemistry (IHC) was employed to assess the clinical relevance of the observations. Small interfering (si)RNA-based silencing transfection methods were carried out to study the function of ENPP2. Results: Totally, 133 unique proteins were identified as differentially expressed in HepG2.2.15 cell line compared with HepG2 cell line. Ectonucleotide pyrophosphatase/phosphodiesterase family member 2 precursor (ENPP2) is one of the most significantly up-regulated secretory proteins associated with HBV replication. This differential expression of ENPP2 was further validated by real-time quantitative RT-PCR, Western Blot and immunohistochemical analysis. To study the function of ENPP2, we knockdown ENPP2 expression in HepG2.2.15 cell line by RNA interference. ENPP2 silencing increased HBV replication approximately 2.3-fold by enhancing, via the type I IFN signaling pathway, HBV cccDNA (covalently closed circular DNA) translation into viral RNA. Moreover, attenuation of ENPP2 expression inhibited both the invasion and migration ability of hepatoma cells in vitro via interacting with the molecules in the tumor microenvironment. Conclusion: Our study demonstrates that ENPP2 may be a novel anti-HBV target and indicate that suppression of its expression may inhibit the invasion and migration ability of hepatoma cells.

show abstract

Glucose-regulated Protein 78 Is an Intracellular Antiviral Factor against Hepatitis B Virus

Cited by 50 publications

References 36 publications

Enterovirus 71 Disrupts Interferon Signaling by Reducing the Level of Interferon Receptor 1

Enterovirus 71 Disrupts Interferon Signaling by Reducing the Level of Interferon Receptor 1

Identification of Essential Filovirion-associated Host Factors by Serial Proteomic Analysis and RNAi Screen

Proteomics Based Identification of Autotaxin As An Anti-Hepatitis B Virus Factor and a Promoter of Hepatoma Cell Invasion and Migration

Contact Info

Product

Resources

About