Glucose-6-phosphate Dehydrogenase Isoenzymes in Human Cell Cultures Determined by Sucrose-Agar Gel and Cellulose Acetate Zymograms

Peterson, Ward D.; Stulberg, Cyril S.; Swanborg, N. K.; Robinson, A.R.

doi:10.3181/00379727-128-33119

Cited by 71 publications

(18 citation statements)

References 1 publication

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Each of the three cell lines was shown to be human by species immuno- Chromosomes of 6410-EBV cells fluorescence (Simpson and Stulberg, 1963). and to have type-B glucose-6-phosphate dehydrogenase (Peterson et al, 1968). Evidence that the superinfected cell line 6410-EBV was related to line 6410, and not to line P3HR-I, was sought by cytogenetic examination and HLA typing.…”

Section: Cytological Characterizationmentioning

confidence: 99%

Productive Epstein‐Barr viral infection of the human lymphoblastoid cell line 6410 with release of early antigen inducing and transforming virus

Traul

Stephens

Gerber

et al. 1977

Intl Journal of Cancer

Self Cite

View full text Add to dashboard Cite

The human lymphoblastoid cell line 6410 was superinfected with P3HR-1 derived Epstein-Barr virus. Subsequent to the first cycle of infection, characterized by early (EA) and virus capsid (VCA) antigen synthesis, the culture, designated 6410-EBV, continued to synthesize VCA. Further immunofluorescence and electron microscopic examination over 18-24 months showed the 6410-EBV culture to be productively infected with EBV. Virus was recovered, in quantity, from the culture fluids and assayed for ability to induce EA synthesis in Raji cells and to transform human umbilical cord lymphocytes. The virus was found to possess both properties, in contrast to P3HR-1 virus which only induces EA. HLA and karyologic analyses of P3HR-1, 6410 and 6410-EBV cultures showed relatedness of 6410-EBV to 6410 cells and dissimilarity to P3HR-1. The biologic activity data coupled with the cytologic analyses confirm a productive infection of the target cells. The reason for differences in biologic activity between the infecting (P3HR-1) and progeny virus is unresolved. It may be speculated that the endogenous EBV genome of 6410 cells was activated and gave rise to a different strain of EBV or to a mixed progeny-parent population as a result of dual infection. Alternatively, the parent strain of virus may have been modfied as a result of interaction with the new host cell.

show abstract

Section: Cytological Characterizationmentioning

confidence: 99%

Productive Epstein‐Barr viral infection of the human lymphoblastoid cell line 6410 with release of early antigen inducing and transforming virus

Traul

Stephens

Gerber

et al. 1977

Intl Journal of Cancer

Self Cite

View full text Add to dashboard Cite

show abstract

“…mitis , tox + [41] CAM-1CDC-E8392 DIP0733:: pCR2.1 TOPO DIP0733 ’[14] INCA 402Isolate from a patient with pneumonia, biovar. Belfanti , tox − [41] Corynebacterium glutamicum ATCC 13032Type strain, non-pathogenic[42]Cell lines Detroit562Human hypopharyngeal carcinoma cells (ATCC CCL-2)[43] HeLaHuman cervical carcinoma cells(ATCC CCL-2)[44, 45]Plasmids pXMJ19 ori colE1 , oriCg , ptac , Cm R [46] pXMJ19_DIP0733 ori colE1 , oriCg , ptac , CDCE8392_0678 , Cm R [14] pXMJ19_DIP0733-ccpXMJ19 with 2700 bp insert of 3′-shortened CDCE8392_0678 (DIP0733 homolog without sequence for C -terminal disorder - and coiled-coil -region) from C. diphtheriae CDC-E8392This study pXMJ19_Cg0896 ori colE1 , oriCg , ptac , Cg0896 , Cm R pXMJ19_Cg0896 + ccpXMJ19 with 2693 bp insert of 3′-shortened Cg0896 (DIP0733 homolog without sequence for C -terminal disorder - and coiled-coil -region) from C. glutamicum ATCC 130323 and 268 bp insert of 5`-shortened CDB402_0643 (DIP0733 homolog sequence for C -terminal disorder - and coiled-coil -region) from C. diphtheriae INCA-402Primers (5`- 3`) Probe 16SrRNAGCAGCCGCGGTAATACGTAGThis studyGGGCCCTAATACGACTCACTATAGGGACATCTCACGACACGAGCTG Probe DIP0733CGACCCAGTGCTTAAGGCATGGGCCCTAATACGACTCACTATACCTGTGCCTGCTTTGGACCC Probe Cg0896GTACGACGGAACTGTTGAACGGGCCCTAATACGACTCACTATAGCCTGCTTTGGACCCTGGGTC pXMJ19_DIP0733-ccCGCG CCTGCA GGTTGGCGACCGGTTTTACGCGCGCG CCCGGG TTACTTAGGGTCAATACCTACCT pXMJ19_Cg0896CGCG CCTGCA GGTTGTCGACTGGTCTCACACCCGCG CCCGGG CTACTGTGCGGACTGGTAGC pXMJ19_Cg0896 + ccCGCGCCTGCAGGTTGTCGACTGGTCTCACACCCGCG CCTTA GGCTGCGATAGGGCTTCAG…”

Section: Methodsmentioning

confidence: 99%

The C-terminal coiled-coil domain of Corynebacterium diphtheriae DIP0733 is crucial for interaction with epithelial cells and pathogenicity in invertebrate animal model systems

et al. 2018

View full text Add to dashboard Cite

BackgroundCorynebacterium diphtheriae is the etiologic agent of diphtheria and different systemic infections. The bacterium has been classically described as an extracellular pathogen. However, a number of studies revealed its ability to invade epithelial cells, indicating a more complex pathogen-host interaction. The molecular mechanisms controlling and facilitating internalization of C. diphtheriae still remains unclear. Recently, the DIP0733 transmembrane protein was found to play an important role in the interaction with matrix proteins and cell surfaces, nematode colonization, cellular internalization and induction of cell death.ResultsIn this study, we identified a number of short linear motifs and structural elements of DIP0733 with putative importance in virulence, using bioinformatic approaches. A C-terminal coiled-coil region of the protein was considered particularly important, since it was found only in DIP0733 homologs in pathogenic Corynebacterium species but not in non-pathogenic corynebacteria. Infections of epithelial cells and transepithelial resistance assays revealed that bacteria expressing the truncated form of C. diphtheriae DIP0733 and C. glutamicum DIP0733 homolog are less virulent, while the fusion of the coiled-coil sequence to the DIP0733 homolog from C. glutamicum resulted in increased pathogenicity. These results were supported by nematode killing assays and experiments using wax moth larvae as invertebrate model systems.ConclusionsOur data indicate that the coil-coiled domain of DIP0733 is crucial for interaction with epithelial cells and pathogenicity in invertebrate animal model systems.Electronic supplementary materialThe online version of this article (10.1186/s12866-018-1247-z) contains supplementary material, which is available to authorized users.

show abstract

“…The epithelial cell lines Detroit-562 (human pharyngeal cancer cells) (Peterson et al, 1968) and A549 (adenocarcinomic human alveolar basal epithelial cells) and the primary endothelial cells HUVEC (human umbilical vein endothelial cells, Roche Clonetics) as well as the endothelial cell line Ea.hy926 (immortalized human umbilical vein cells) (Edgell et al, 1983) were used in this work.…”

Section: Methodsmentioning

confidence: 99%

The IL-8 protease SpyCEP is detrimental for Group A Streptococcus host-cells interaction and biofilm formation

Andreoni

Ogawa

et al. 2014

Front. Microbiol.

View full text Add to dashboard Cite

SpyCEP-mediated chemokine degradation translates into more efficient spreading and increased severity of invasive Group A Streptococcus (GAS) infections, due to impaired neutrophil recruitment to the site of infection. SpyCEP is markedly up-regulated in invasive as compared to colonizing GAS isolates raising the question whether SpyCEP expression hinders bacterial attachment and thus colonization of the host. To address this question we used a molecular approach involving the use of homologous GAS strains either expressing or not SpyCEP or expressing an enzymatically inactive variant of SpyCEP. We found that expression of enzymatically functional SpyCEP lowered GAS adherence and invasion potential toward various epithelial and endothelial cells. SpyCEP also blunted biofilm formation capacity. Our data indicate that expression of SpyCEP decreases colonization and thus might be detrimental for the spreading of GAS.

show abstract

Glucose-6-phosphate Dehydrogenase Isoenzymes in Human Cell Cultures Determined by Sucrose-Agar Gel and Cellulose Acetate Zymograms

Cited by 71 publications

References 1 publication

Productive Epstein‐Barr viral infection of the human lymphoblastoid cell line 6410 with release of early antigen inducing and transforming virus

Productive Epstein‐Barr viral infection of the human lymphoblastoid cell line 6410 with release of early antigen inducing and transforming virus

The C-terminal coiled-coil domain of Corynebacterium diphtheriae DIP0733 is crucial for interaction with epithelial cells and pathogenicity in invertebrate animal model systems

The IL-8 protease SpyCEP is detrimental for Group A Streptococcus host-cells interaction and biofilm formation

Contact Info

Product

Resources

About