Getting Started with Microbiome Analysis: Sample Acquisition to Bioinformatics

Abstract

Historically, in order to study microbes, it was necessary to grow them in the laboratory. It was clear though that many microbe communities were refractory to study because none of the members could be grown outside of their native habitat. The development of culture‐independent methods to study microbiota using high‐throughput sequencing of the 16S ribosomal RNA gene variable regions present in all prokaryotic organisms has provided new opportunities to investigate complex microbial communities. In this unit, the process for a microbiome analysis is described. Many of the components required for this process may already exist. A pipeline is described for acquisition of samples from different sites on the human body, isolation of microbial DNA, and DNA sequencing using the Illumina MiSeq sequencing platform. Finally, a new analytical workflow for basic bioinformatics data analysis, QWRAP, is described, which can be used by clinical and basic science investigators. Curr. Protoc. Hum. Genet. 82:18.8.1‐18.8.29. © 2014 by John Wiley & Sons, Inc.

Gut Microbial Dysbiosis Due to Helicobacter Drives an Increase in Marginal Zone B Cells in the Absence of IL-10 Signaling in Macrophages

“…The isolated tissues were homogenized and bacterial DNA was isolated using MO BIO Power Analyzer kit (MO BIO Laboratories, Inc., Carlsbad, CA) and PCR was used with unique bar coded primers to amplify the V4 region of the 16S rRNA gene to create an “amplicon library” from individual samples (36, 37). The 5′ primer was: 5′AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTGCCAGCMGCCGGGTAA3′ and the 3′ primer was: 5′CAAGAGAAGACGGCATACGAGATNNNNNNAGTCAGTCAGCCGGACTACHVGGGWTCTAAT3′.…”

Response of Germfree Mice to Colonization by Oxalobacter formigenes and Altered Schaedler Flora

“…PCR with unique bar-coded primers was used to amplify the V4 region of the 16S rRNA gene from individual samples, to create an amplicon library (23). The oligonucleotide primers (Eurofins Genomics, Inc., Huntsville, AL) used for PCR amplification of the V4 region of the 16S rRNA gene were as follows: forward V4, 5=-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT ATG GTA ATT GTG TGC CAG CMG CCG CGG TAA-3=; and reverse V4, 5=-CAA GAG AAG ACG GCA TAC GAG ATN NNN NNA GTC AGT CAG CCG GAC TAC HVG GGT WTC TAA T-3=.…”

“…The PCR products were sequenced using the Illumina MiSeq platform (23). Paired-end reads of approximately 250 bp from the V4 region of the 16S rRNA gene were analyzed.…”

“…Paired-end reads of approximately 250 bp from the V4 region of the 16S rRNA gene were analyzed. The samples were quantitated using Pico Green, adjusted to a concentration of 4 nM, and then used for sequencing with the Illumina MiSeq system (23). FASTQ conversion of the raw data files was performed following demultiplexing.…”

“…Quality control of the FASTQ files was performed, with quality assessment and filtering using the FASTX toolkit. The rest of the steps were performed using the QIIME suite (version 1.8) (23)(24)(25).…”