Germ‐line transmission of a myocardium‐specific GFP transgene reveals critical regulatory elements in the cardiac myosin light chain 2 promoter of zebrafish

Abstract

In response to the lack of a transgenic line of zebrafish labeled with heart-specific fluorescence in vivo to serve as a research model, we cloned a 1.6-kb polymerase chain reaction (PCR) -product containing the upstream sequence (؊870 bp), exon 1 (39 bp), intron 1 (682 bp), and exon 2 (69 bp) of the zebrafish cardiac myosin light chain 2 gene, (cmlc2). A germ-line transmitted zebrafish possessing a green fluorescent heart was generated by injecting this PCR product fused with the green fluorescent protein (GFP) gene with ends consisting of inverted terminal repeats of an adeno-associated virus. Green fluorescence was intensively and specifically expressed in the myocardial cells located both around the heart chambers and the atrioventricular canal. Neither the epicardium nor the endocardium showed fluorescent signals. The GFP expression in the transgenic line faithfully recapitulated with the spatial and temporal expression of the endogenous cmlc2. Promoter analysis showed that the fragment consisting of nucleotides from ؊210 to 34 (؊210/34) was sufficient to drive heart-specific expression, with a ؊210/؊73 motif as a basal promoter and a ؊210/؊174 motif as an element involved in suppressing ectopic (nonheart) expression. Interestingly, a germ-line of zebrafish whose GFP appeared ectopically in all muscle types (heart, skeletal, and smooth) was generated by injecting the fragment including a single nucleotide mutation from G to A at ؊119, evidence that A at ؊119 combined with neighboring nucleotides to create a consensus sequence for binding myocyte-specific enhancer factor-2. Developmental Dynamics 228:30 -40, 2003.

Mutation in sodium–calcium exchanger 1 (NCX1) causes cardiac fibrillation in zebrafish

“…A morpholino antisense oligonucleotide (Gene Tools, Philomath, OR) complementary to the translation start site of NCX1h and its flanking sequence (NCX1hMO, GATGAAGTCCCAGATTGGCCCATGT) was synthesized. At the one-to two-cell stage, 1.5 ng of NCX1hMO was injected into cmlc2::EGFP transgenic embryos (17). Cardiac phenotypes were examined by digital imaging and whole-mount in situ hybridization at 24 hpf and 50 hpf.…”

Illuminating cardiac development: Advances in imaging add new dimensions to the utility of zebrafish genetics

“…Visualization of myocardial and endocardial cells has been greatly enhanced by transgenes that express gfp in cardiomyocytes (e.g. Tg(cmlc2:egfp)) [43] or endothelial cells (e.g. Tg(flk1:egfp)) [24].…”

“…Examination of cardiac cytoarchitecture demonstrates that the migrating myocardium is a polarized epithelium. (A,B) Confocal images of transverse sections, dorsal to the top, of Tg (cmlc2:egfp) [43] embryos at the 20-somite stage, as in [29]. Expression of Tg(cmlc2:egfp) (pseudocolored blue) indicates bilateral populations of cardiomyocytes in the process of cardiac fusion.…”

“…Immunohistochemistry for β-catenin (red), PRKCi (green, A), and Fibronectin High-speed imaging facilitates the tracking of cardiomyocyte trajectories during cardiac contraction. (A-D) Series of 3D renderings documenting cardiac contraction in a Tg (cmlc2:egfp) [43] embryo at 26 hpf. The trajectories (orange tracks) of individual cardiomyocytes (yellow balls) are indicated.…”

Real-time optical gating for three-dimensional beating heart imaging

“…All the images shown here are of transgenic four-day-old zebrafish embryos expressing green fluorescent protein within its cardiomyocytes tg(myl7:gfp). 22 The embryos were immobilized with ethyl 3-aminobenzoate methanesulfonic acid (Tricaine R ) to reduce movement and contained within an index-matched tube of FEP polymer. 23 Although our intention is not to provide comprehensive biological analysis of the results here, water-dipping objective (Obj1).…”