Germ-Line Mutation Analysis in Patients with Multiple Endocrine Neoplasia Type 1 and Related Disorders

Abstract

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant syndrome predisposing to tumors of the parathyroid, endocrine pancreas, anterior pituitary, adrenal glands, and diffuse neuroendocrine tissues. The MEN1 gene has been assigned, by linkage analysis and loss of heterozygosity, to chromosome 11q13 and recently has been identified by positional cloning. In this study, a total of 84 families and/or isolated patients with either MEN1 or MEN1-related inherited endocrine tumors were screened for MEN1 germ-line mutations, by heteroduplex and sequence analysis of the MEN1 gene-coding region and untranslated exon 1. Germ-line MEN1 alterations were identified in 47/54 (87%) MEN1 families, in 9/11 (82%) isolated MEN1 patients, and in only 6/19 (31.5%) atypical MEN1-related inherited cases. We characterized 52 distinct mutations in a total of 62 MEN1 germ-line alterations. Thirty-five of the 52 mutations were frameshifts and nonsense mutations predicted to encode for a truncated MEN1 protein. We identified eight missense mutations and five in-frame deletions over the entire coding sequence. Six mutations were observed more than once in familial MEN1. Haplotype analysis in families with identical mutations indicate that these occurrences reflected mainly independent mutational events. No MEN1 germ-line mutations were found in 7/54 (13%) MEN1 families, in 2/11 (18%) isolated MEN1 cases, in 13/19 (68. 5%) MEN1-related cases, and in a kindred with familial isolated hyperparathyroidism. Two hundred twenty gene carriers (167 affected and 53 unaffected) were identified. No evidence of genotype-phenotype correlation was found. Age-related penetrance was estimated to be >95% at age >30 years. Our results add to the diversity of MEN1 germ-line mutations and provide new tools in genetic screening of MEN1 and clinically related cases.

Clinical testing for multiple endocrine neoplasia type 1 in a DNA diagnostic laboratory

“…7 Among pedigrees strictly defined as having familial MEN1, we found mutations in 76.3%, which approaches the rates reported by others. 8,20,22,26,33,34 In pedigrees that do meet the diagnostic criteria for familial MEN1, a failure to find mutations in the MEN1 gene could reflect the presence of functionally significant intronic muta- Fig. 1.…”

“…Haplotyping around a recurrent 249delGTCT mutation was performed by PCR amplification of a microsatellite locus at the human muscle glycogen phosphorylase gene (PYGM) a polymorphic marker that lies approximately 55 kb 3' to the MEN1 gene, 16,20,26 and a CA repeat in the region of the MEN1 gene 1680 bp 5' to the start of exon 1 that was developed as part of this study. The primer sequences used to amplify this latter marker were as follows: F cgcctaattttgtgtgtatg; R agctgggaatccctgtctctg.…”

Multiple endocrine neoplasia phenocopy revealed as a co‐occurring neuroendocrine tumor and familial hypocalciuric hypercalcemia type 3

“…The NET found in our index patient was located to the hindgut, which is very rare in MEN1. In addition, the patient was negative for all mutations known to cause MEN1, although about 5–15% of considered MEN1 cases are genetically unverified 17, 23, 24. Furthermore, only the index patient had affection of more than one organ, and as the penetrance of MEN1 is close to 100% in patients older than 50 years, it is unlikely that the 71‐year‐old father should be unaffected 20, 25.…”

Identification and characterization of JunD missense mutants that lack menin binding

“…It is caused by heterozygous inactivating germline mutations in the MEN1 tumor suppressor gene located on chromosome 11q13 and the subsequent inactivation of the normal allele in the tumor tissue Agarwal et al, 1997;Lemmens et al, 1997;Bartsch et al, 1998;Bassett et al, 1998;Giraud et al, 1998;Mutch et al, 1999;Poncin et al, 1999;Teh et al, 1998;Hai et al, 1999). MEN1 mutations also occur as somatic mutations accompanied by 11q13 LOH in sporadic MEN1-like tumors including gastrinomas, insulinomas, parathyroid adenomas, bronchial carcinoid tumors, and angio®bromas (reviewed in .…”