Genotype-Specific Transcriptional Regulation of PAI-1 Gene by Insulin, Hypertriglyceridemic VLDL, and Lp(a) in Transfected, Cultured Human Endothelial Cells

Abstract

Abstract-Plasminogen activator inhibitor-1 (PAI-1) has been shown to be an independent risk factor for coronary artery disease. Variations in plasma PAI-1 levels have been attributed to variations in the PAI-1 gene, and associations between PAI-1 levels and PAI-1 genotypes suggest that PAI-1 expression may be regulated in a genotype-specific manner by insulin, hypertriglyceridemic (HTG) very low density lipoprotein (VLDL), or lipoprotein(a) [Lp(a)]. Polymerase chain reaction-amplified 1106-bp fragments of the promoter of the 1/1 and 2/2 PAI-1 genotypes were sequenced and showed 5 regions of small nucleotide differences in the 1/1 versus 2/2 PAI-1 promoters that consistently occurred with high frequency. These fragments were ligated into the luciferase reporter gene, and 1/1 and 2/2 PAI-1 genotype human umbilical vein endothelial cell (HUVEC) cultures were transiently transfected with their respective p1PAI110/luc and p2PAI110/luc constructs and vice versa. Insulin induced an Ϸ12-to 16-fold increase in luciferase activity in both the 1/1 and 2/2 PAI-1 genotype HUVEC cultures transfected with the p1PAI110/luc construct. HTG-VLDL and Lp(a) induced luciferase activity by Ϸ14-to 16-and Ϸ8-to 11-fold, respectively, in both the 1/1 and 2/2 PAI-1 genotype HUVEC cultures transfected with the p2PAI110/luc construct. The positive control interleukin-1 showed an Ϸ7-to 12-fold response in the 1/1 and 2/2 PAI-1 genotype HUVEC cultures transfected with either of the constructs. These cross-over results demonstrate that regulation of either the 1/1 or 2/2 PAI-1 genotype by its respective inducer is due to the promoter itself and not to some factor(s) expressed differently in the 1/1 or 2/2 PAI-1 genotype HUVEC cultures. I mpaired fibrinolysis and hypercoagulability have been suggested as predisposing factors for coronary artery thrombosis, which may have an important role in the pathogenesis of coronary artery disease (CAD) and myocardial infarction (MI).1,2 Young survivors of MI have reduced fibrinolytic activity, increased plasminogen activator inhibitor-1 (PAI-1) levels, and an "impaired release" of tissue plasminogen activator, suggesting that reduced fibrinolytic activity, presumably endothelial cell (EC) related, may have pathogenic importance in MI.2 Certain risk factors for CAD, including hyperinsulinemia and hypertriglyceridemic (HTG) VLDL, have been associated with an increase in plasma PAI-1 antigen and activity levels. Because PAI-1 is generally considered to be a major regulator of fibrinolysis through its interaction with plasminogen activators, 3,4 it is conceivable that the elevated blood levels of PAI-1 in hyperinsulinemic and hyperlipoproteinemic subjects may in part explain their increased thrombotic risk and CAD prevalence that are unexplained by conventional risk factors. [5][6][7][8] Recent studies have shown that variations in the PAI-1 gene sequence may be closely associated with the regulation of PAI-1 expression and therefore, the increased risk for thrombosis. 9 In addition, several studies have indic...

A Forkhead/Winged Helix-related Transcription Factor Mediates Insulin-increased Plasminogen Activator Inhibitor-1 Gene Transcription

“…Insulin or proinsulin infusion can cause local elevation of PAI-1 detected by analysis of PAI-1 protein levels (33)(34)(35) or by in situ hybridization (36). Insulin also increases expression of the endogenous PAI-1 gene in HepG2 cells (37) and the transcription of a luciferase reporter plasmid under control of the PAI-1 promoter in human umbilical vein endothelial cells (HUVEC) in culture (38,39). The insulin response element was suggested to be in the region Ϫ98/Ϫ62, but this was never confirmed by mutational analysis of the PAI-1 promoter (40).…”

Stimulation of Interleukin-8 Production in Human THP-1 Macrophages by Apolipoprotein(a)

“…In an endothelial cell system, native Lp(a), via apo(a), has been shown to stimulate the production of adhesion molecules such as intercellular adhesion molecule (11), vascular cell adhesion molecule-1 (12), and E-selectin (12), as well as endothelin-1 (13) and I-309, a potent chemoattractant for monocytes (14). Native Lp(a) has also been reported to enhance endothelial plasminogen activator inhibitor-1 expression (15,16), although those data have not been corroborated by other studies (13,17). Moreover, in a vascular smooth muscle cell system, native Lp(a), and particularly apo(a), was shown to inhibit the proteolytic activation of transforming factor ␤ via a decrease in cell surface generation of plasmin, resulting in increased vascular smooth muscle cells proliferation (18).…”

Hypertriglyceridemic VLDL Downregulates Tissue Plasminogen Activator Gene Transcription Through cis -Repressive Region(s) in the Tissue Plasminogen Activator Promoter in Cultured Human Endothelial Cells

“…39 The PCR was carried out with use of an upstream primer (5Ј CGATCGGTACCCCATTGTCACCTTATCAGCCTGCCC 3Ј) identical to positions 1473 to 1497 and downstream primer (5Ј GATCAGATCTTCCTCGCAGAGGTTTCTCTCCAGC 3Ј) complementary to positions 3692 to 3668 of the human tPA gene. 33 Both these primers had a CGATC clamp and a KpnI site in the upstream primer (underlined) and a BglII site in the downstream primer (underlined) to aid in the subsequent cloning into the luciferase reporter gene (luc, pGL3-basic expression vector, Promega Corp).…”

“…Detailed sequencing analyses were carried out with duplicate PCR clones from single PCR amplification of 8 individual (16 sequences) promoter fragments to rule out errors due to PCR cloning or sequencing, as described previously. 39 Sequencing was carried out on both strands by the UAB Automated DNA Sequencing Core Facility.…”