Genomic surveillance reveals multiple introductions of SARS-CoV-2 into Northern California

Abstract

The COVID-19 pandemic caused by the novel coronavirus SARS-CoV-2 has spread globally, with >52,000 cases in California as of May 4, 2020. Here we investigate the genomic epidemiology of SARS-CoV-2 in Northern California from late January to mid-March 2020, using samples from 36 patients spanning 9 counties and the Grand Princess cruise ship. Phylogenetic analyses revealed the cryptic introduction of at least 7 different SARS-CoV-2 lineages into California, including epidemic WA1 strains associated with Washington State, with lack of a predominant lineage and limited transmission between communities. Lineages associated with outbreak clusters in 2 counties were defined by a single base substitution in the viral genome. These findings support contact tracing, social distancing, and travel restrictions to contain SARS-CoV-2 spread in California and other states.

Genetic Grouping of SARS-CoV-2 Coronavirus Sequences using Informative Subtype Markers for Pandemic Spread Visualization

“…According to our ISM analysis, this subtype is separated by a hamming distance of 3 from one of the major subtype of the outbreak in China, CCACCTGCCCACAAGGCGGG (the differences are at ISM positions 10, 11 and 12). Viral spread is suspected to be due to primary exposure of an individual from China to Washington state, designating this case as "WA1" [17,61]. "WA1" lineage is 27/44 noted to have three characteristic SNVs, namely, C17747T, A17858G, and C18060T which correspond matches with our ISM positions of 10, and 12 respectively [16-18, 61, 62].…”

“…Subsequently, further diversity was recognized as the virus continued to spread, and researchers developed a consensus reference sequence for SARS-CoV-2, to which other sequences may be compared [13]. Researchers have continued to publish studies of the specific variants in the context of localized outbreaks, such as the Diamond Princess cruise ship [14], as well as regional outbreaks and their international connections [12,[15][16][17][18].…”

Genomic surveillance of SARS-CoV-2 reveals community transmission of a major lineage during the early pandemic phase in Brazil

“…Genomic epidemiology has been a useful tool to track the community transmission of SARS-CoV-2 in different geographical settings. Previous studies revealed that SARS-CoV-2 epidemics in Australia 9,10 , Belgium 11 , Denmark 12 , France 13 , Iceland 14 , Israel 15 , Netherlands 16 Spain 17 and the United States (US) 18–20 , resulted from multiple independent introductions, followed by community dissemination of some viral strains that resulted in the emergence of national (or local) transmission clusters. Early phylogenetic analyses of SARS-CoV-2 complete genomes from the Brazilian states of Minas Gerais 21 , Sao Paulo 22 and Amazonas 23 , revealed multiple independent viral importations and limited local spread during the initial stage of the SARS-CoV-2 epidemic in Brazil.…”

Whole Genome Sequencing of SARS-CoV-2: Adapting Illumina Protocols for Quick and Accurate Outbreak Investigation During a Pandemic

“…Genomic sequencing can be used to rapidly and accurately identify the transmission routes of the pathogen [4,5]. This can then be used to trace the path of transmission within a population and to possibly identify the probable source, potentially leading to an improved public health response [6][7][8][9][10][11][12].…”