Genomic Characterization of a Novel HIV Type 1 B/G Intersubtype Recombinant Strain from an Injecting Drug User in Germany

Harris, Barbara J.; Truchsess, Inge Von; Schätzl, Hermann; Devare, Sushil G.; Hackett, John

doi:10.1089/aid.2005.21.654

Cited by 9 publications

(13 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although 9196/01 has a B/G recombinant composition and contains some regions closely related to CRF14_BG, it is clearly distinguishable from this CRF due to the subtype B-derived region within pol IN [Delgado et al, 2002]. This has since been confirmed based on full length genome analysis [Harris et al, 2005]. The phylogenetic relatedness between 9196/01 and CRF14_BG reference strains supports the contention that this patient was infected in Portugal.…”

Section: Discussionsupporting

confidence: 60%

The first B/G intersubtype recombinant form of human immunodeficiency virus type 1 (HIV-1) identified in Germany was undetected or underquantitated by some commercial viral load assays

et al. 2006

Self Cite

View full text Add to dashboard Cite

The high level of genetic diversity of human immunodeficiency virus type 1 (HIV-1) and the continual emergence of recombinant forms have important implications not only for the global evolution of HIV but also for diagnosis, monitoring, and treatment strategies. The present study reports the first intersubtype B/G recombinant strain of HIV-1 in Germany. This strain is notable from a clinical perspective, since it was undetectable in the NucliSens HIV-1 QT assay (Organon Tecknika/bioMérieux) and was significantly underquantitated in the Monitor v1.5 test (Roche Molecular Systems) relative to the LCx HIV RNA Quantitative assay (Abbott Laboratories). Gag-encoded p24 (gag p24), pol-encoded integrase (pol IN), and env-encoded gp41 (env gp41) immunodominant region (IDR) sequences were characterized to establish group and subtype designation and to evaluate the degree of genetic diversity at primer and probe binding sites of the viral load assays. Phylogenetic analysis revealed that this virus is an intersubtype B/G recombinant strain. The gag p24 region is subtype G, env gp41 IDR is subtype B, and pol IN is a B/G chimera. Nucleotide mismatches within primer and probe-binding sites provided the molecular basis for differences in quantitation observed between viral load assays. Genetic diversity of HIV-1 continues to challenge the reliability of detection and quantitation by viral load assays.

show abstract

Section: Discussionsupporting

confidence: 60%

The first B/G intersubtype recombinant form of human immunodeficiency virus type 1 (HIV-1) identified in Germany was undetected or underquantitated by some commercial viral load assays

et al. 2006

Self Cite

View full text Add to dashboard Cite

show abstract

“…Product 1 of 1.2 kb spanning the 5Ј long terminal repeat (LTR) through gag was generated using RE9737F-2 with M/Op24-7 and RE9745F-2 with M/Op24-6. 7 AATTGGCTCAAAGGTTAC; nt 6846-6871) and 13pef226 (5Ј GGGTTTATTACAGGGACAGCAGAGAC; nt 4900-4925)/ ear26. Product 6 of 1.5 kb env gp120 through env gp41 was amplified with primers ebf27 (5Ј CTATTTTGTGCATCT-GATGCTAAAGCA; nt 6378-6404)/13per27 (5Ј TTAATGC-CCCAGACCGTGAGTTTCAAC; nt 7919-7945) and ebf27/ ebr219 (5Ј TTGTCTGGCCTGTACCGTC; nt 7835-7853).…”

mentioning

confidence: 99%

Near Full-Length Genome Characterization of Three Additional HIV Type 1 CRF13_cpx Strains from Cameroon

Luk

Holzmayer

Yamaguchi

et al. 2007

AIDS Research and Human Retroviruses

Self Cite

View full text Add to dashboard Cite

Recombinant forms of HIV-1 contribute significantly to the ongoing epidemic. In the present study, we characterized the near full-length genomes of three candidate HIV-1 CRF13_cpx strains originating in Cameroon, 04CM-173-9, 04CM-632-28, and 02CM-A1394. Bootscanning, recombination breakpoint analysis, and phylogenetic trees confirmed similar genomic structures with identical breakpoint positions compared to the three available CRF13_cpx sequences. The candidate and reference sequences formed a distinct cluster well separated from other group M subtypes and had a mosaic structure derived from subtypes A1, G, J, and CRF01_AE. The similarity in genomic composition and position of recombination breakpoints suggest that these isolates share a common ancestor. The epidemiological significance of CRF13_cpx strains in Cameroon is unknown; however, the availability of three additional genomic sequences will improve our understanding of the overall genetic diversity within this recombinant form of HIV-1.

show abstract

“…The early nucleic acid-based assays (NAT) used to monitor viral loads in HIV-1 infected patients were impacted by the genetic variability between HIV-1 subtypes resulting in under quantification of or failure to detect some non-B viruses [Swanson et al, 2000[Swanson et al, , 2005Geelan et al, 2003;Harris et al, 2005;Lee et al, 2006]. While the high genetic diversity in HIV-1 continues to pose a challenge for NAT, at least one real-time HIV-1 viral load assay has been designed to address this issue [Swanson et al, 2006a[Swanson et al, ,b, 2007.…”

Section: Hiv-1 Non-b Strains In Usmentioning

confidence: 99%

Review of status of HIV strain diversity in the United States

Brennan

2007

J. Med. Virol.

View full text Add to dashboard Cite

Genomic Characterization of a Novel HIV Type 1 B/G Intersubtype Recombinant Strain from an Injecting Drug User in Germany

Cited by 9 publications

References 16 publications

The first B/G intersubtype recombinant form of human immunodeficiency virus type 1 (HIV-1) identified in Germany was undetected or underquantitated by some commercial viral load assays

The first B/G intersubtype recombinant form of human immunodeficiency virus type 1 (HIV-1) identified in Germany was undetected or underquantitated by some commercial viral load assays

Near Full-Length Genome Characterization of Three Additional HIV Type 1 CRF13_cpx Strains from Cameroon

Review of status of HIV strain diversity in the United States

Contact Info

Product

Resources

About