Genome-Wide Identification of Genes Required for Fitness of Group A Streptococcus in Human Blood

Abstract

The group A streptococcus (GAS) is a strict human pathogen responsible for a wide spectrum of diseases. Although GAS genome sequences are available, functional genomic analyses have been limited. We developed a mariner-based transposon, osKaR, designed to perform Transposon-Site Hybridization (TraSH) in GAS and successfully tested its use in several invasive serotypes. A complex osKaR mutant library in M1T1 GAS strain 5448 was subjected to negative selection in human blood to identify genes important for GAS fitness in this clinically relevant environment. Mutants underrepresented after growth in blood (output pool) compared to growth in rich media (input pool) were identified using DNA microarray hybridization of transposon-specific tags en masse. Using blood from three different donors, we identified 81 genes that met our criteria for reduced fitness in blood from at least two individuals. Genes known to play a role in survival of GAS in blood were found, including those encoding the virulence regulator Mga (mga), the peroxide response regulator PerR (perR), and the RofA-like regulator Ralp-3 (ralp3). We also identified genes previously reported for their contribution to sepsis in other pathogens, such as de novo nucleotide synthesis (purD, purA, pyrB, carA, carB, guaB), sugar metabolism (scrB, fruA), zinc uptake (adcC), and transcriptional regulation (cpsY). To validate our findings, independent mutants with mutations in 10 different genes identified in our screen were confirmed to be defective for survival in blood bactericidal assays. Overall, this work represents the first use of TraSH in GAS to identify potential virulence genes.

GacA is essential for Group A Streptococcus and defines a new class of monomeric dTDP‐4‐dehydrorhamnose reductases (RmlD)

“…The pKRMIT plasmid contains a mariner mini‐transposon named Krmit ( K anamycin‐ r esistant element for m assive i dentification of t ransposants) modified for Tn‐seq (Le Breton et al ., 2015) and was used to perform saturating transposition for random mutagenesis in GAS 5448 and NZ131 as previously described for the mariner transposon Oskar (Le Breton and McIver, 2013; Le Breton et al ., 2013). Tn‐seq (van Opijnen and Camilli, 2010) was performed as described recently (Le Breton et al ., 2015) with the following primers oKrmit‐Tnseq2 (5′‐CAAGCAGAAGACGGCATACGAAGCGCCTACG‐AGGAATTTGTATCG‐3′) and oAdapterPCR (5′‐ACACTCTTTCCCTACACGACGCTCTT‐CCGATCT‐3′), resulting in the production of 176 bp Krmit insertion tags.…”

Functional and Structural Properties of a Novel Protein and Virulence Factor (Protein sHIP) in Streptococcus pyogenes

“…As expected, a knock-out of mga encoding Mga, a positive regulator of the mga regulon, created a mutant with reduced survival. In relation to the present work, it is interesting that another of the mutants that showed reduced fitness in human blood was a mutant in the gene encoding sHIP (designated M5005_Spy_1730 in the study by Le Breton et al (74)). The demonstration here that patients with invasive and severe S. pyogenes infection are more prone to develop IgG antibodies against sHIP than patients with superficial infection further indicates a role for the protein in S. pyogenes pathogenesis.…”

“…There are in total 14 genes found in this region, including several uncharacterized proteins, such as sHIP, but also a number of genes encoding for proteins involved in protein transport and efflux (M5005_Spy_1726, Q99XU4; M5005_Spy_1727, Q99XU3; M5005_Spy_1728, Q99XU2). In a recent study (74), the relevance of several S. pyogenes genes, including sHIP, was tested. Transposon site hybridization was used to create a mutant library that was subsequently tested in human blood to identify genes important for S. pyogenes survival in this environment.…”

ThefruRBAOperon Is Necessary for Group A Streptococcal Growth in Fructose and for Resistance to Neutrophil Killing during Growth in Whole Human Blood

“…Our previous genome-wide screen to identify genes required for GAS 5448 fitness in whole human blood identified the putative PTS fructose enzyme II (EII) gene fruA (15), suggesting a role for fructose utilization in host survival. To determine the effect of fructose on GAS gene expression, we conducted RNA transcriptome sequencing (RNA-Seq) in order to assess how fructose affects global transcription.…”

“…In the zoonotic pathogen Streptococcus iniae, fruA was found in the genomes of five virulent strains but was absent from nonvirulent strains (14). In GAS, a TraSH (for transposon-site hybridization) screen found fruA was a gene critical for the survival of GAS in whole human blood (15). The transcription of fruA also was induced in an analysis of global heme stress in GAS (16), a condition likely encountered during bloodstream infection.…”