Genome-Wide Identification and Expression Analysis of the NAC Gene Family in Kandelia obovata, a Typical Mangrove Plant

Abstract

The NAC (NAM, ATAF1/2, and CUC2) gene family, one of the largest transcription factor families in plants, acts as positive or negative regulators in plant response and adaption to various environmental stresses, including cold stress. Multiple reports on the functional characterization of NAC genes in Arabidopsis thaliana and other plants are available. However, the function of the NAC genes in the typical woody mangrove (Kandelia obovata) remains poorly understood. Here, a comprehensive analysis of NAC genes in K. obovata was performed with a pluri-disciplinary approach including bioinformatic and molecular analyses. We retrieved a contracted NAC family with 68 genes from the K. obovata genome, which were unevenly distributed in the chromosomes and classified into ten classes. These KoNAC genes were differentially and preferentially expressed in different organs, among which, twelve up-regulated and one down-regulated KoNAC genes were identified. Several stress-related cis-regulatory elements, such as LTR (low-temperature response), STRE (stress response element), ABRE (abscisic acid response element), and WUN (wound-responsive element), were identified in the promoter regions of these 13 KoNAC genes. The expression patterns of five selected KoNAC genes (KoNAC6, KoNAC15, KoNAC20, KoNAC38, and KoNAC51) were confirmed by qRT-PCR under cold treatment. These results strongly implied the putative important roles of KoNAC genes in response to chilling and other stresses. Collectively, our findings provide valuable information for further investigations on the function of KoNAC genes.

Genome-wide identification, evolution, and expression analysis of the NAC gene family in chestnut (Castanea mollissima)

“…These results suggested that members of the CmNAC gene family were closely related to the growth and development of chestnut. Additionally, a large number of cis -acting elements related to plant resistance to stress were identified, such as wound-responsive elements, cis -acting elements involved in defense and stress responsiveness ( Figure 4 ; Supplementary Table S4 ) ( Sun et al, 2022 ).…”

Characterization of NAC Gene Family in Ammopiptanthus mongolicus and Functional Analysis of AmNAC24, an Osmotic and Cold-Stress-Induced NAC Gene

“…Analysis based on KaKs calculations reveals that all duplicate gene pairs evolved under purifying selection, indicating that A. mongolicus has become well adapted to extreme environments of cold and drought through long-term evolution. Phylogenetic analysis showed that AmNACs are divided into 15 groups, which is like the NAC family in Isatis indigotica [62], but different from Kandelia bovate (16 groups) [64] and Dimocarpus longan (14 groups) [65]. The NAC family is categorized into three subfamilies: NAM, ATAF, and CUC.…”

NRAMP gene family in Kandelia obovata: genome-wide identification, expression analysis, and response to five different copper stress conditions

“…The ABI PRISM 7500 Real-time PCR Systems, manufactured by Applied Biosystems, were utilized in this study to perform quantitative real-time PCR (qRT-PCR) assays. The 2 −∆∆CT approach, as previously outlined ( Hussain et al., 2022c ; Sun et al., 2022 ), was employed for data analysis. The actin gene of Kandelia obovata (KoActin) was used as a reference gene using the sequence given by Sun et al., 2022 (forward primer: CAATGCAGCAGTTGAAGGAA, reverse primer: CTGCTGGAAGGAACCAAGAG).…”

“…The 2 −∆∆CT approach, as previously outlined ( Hussain et al., 2022c ; Sun et al., 2022 ), was employed for data analysis. The actin gene of Kandelia obovata (KoActin) was used as a reference gene using the sequence given by Sun et al., 2022 (forward primer: CAATGCAGCAGTTGAAGGAA, reverse primer: CTGCTGGAAGGAACCAAGAG). The KoNRAMPs gene primers utilized in real-time PCR are listed in Table 1 and were created with the PRIMER 5.0 software ( http://www.premierbiosoft.com ) ( Hussain et al., 2023 ).…”