Genome-Wide Assessment of Efficiency and Specificity in CRISPR/Cas9 Mediated Multiple Site Targeting in Arabidopsis

Abstract

Simultaneous multiplex mutation of large gene families using Cas9 has the potential to revolutionize agriculture and plant sciences. The targeting of multiple genomic sites at once raises concerns about the efficiency and specificity in targeting. The model Arabidopsis thaliana is widely used in basic plant research. Previous work has suggested that the Cas9 off-target rate in Arabidopsis is undetectable. Here we use deep sequencing on pooled plants simultaneously targeting 14 distinct genomic loci to demonstrate that multiplex targeting in Arabidopsis is highly specific to on-target sites with no detectable off-target events. In addition, chromosomal translocations are extremely rare. The high specificity of Cas9 in Arabidopsis makes this a reliable method for clean mutant generation with no need to enhance specificity or adopt alternate Cas9 variants.

CLAVATA1 controls distinct signaling outputs that buffer shoot stem cell proliferation through a two-step transcriptional compensation loop

“…I therefore used Cas9 to target CRN and create a null mutant. I created a gRNA targeting the signal sequence encoding region of the CRN gene and used the pCUT series of Cas9 vectors to create indels in the CRN gene in the Col-0 ecotype [36]. One of these, hereby referred to as crn-10 , introduced a single thymine base between bases 20 and 21 in the CRN CDS.…”

“…The pCUT vector system was used to generate the crn-10 allele and rpk2-cr allele used here [36]. Briefly, this vector series co-expresses nuclear targeted Cas9 from the UBQUITIN10 promoter and gRNAs from the U6 promoter.…”

“…A 20 base pair gRNA target site (bold), including upstream G and downstream PAM (underlined) was selected g aagcaaagaagaagaagaaa tgg near the initiator methionine codon in the CRN genomic signal sequence encoding region. This target site was used to generate a gRNA that was cloned into pCUT3 as described in [36]. Kanamycin resistant plants were selected in the T1.…”

New traits in crops produced by genome editing techniques based on deletions

“…Peterson et al (2016) targeted 14 loci simultaneously in A. thaliana with CRISPR-Cas using stacked gRNA expression arrays (Peterson et al 2016). Steinert et al (2015) simultaneously used two alternative modified Cas proteins, and each was directed by its own gRNA.…”

Risk associated with off-target plant genome editing and methods for its limitation

“…When the sgRNA sequence recognizes partial mismatches outside the seed sequence instead of on-target sites, then off-target edits will be produced. With the further development of CRISPR/Cas9 techniques benefiting from greater specificity in sgRNA design, minimal off-target binding activity and the absence of off-target mutations have been reported in zebrafish [43], mice [44], chicken [45], stem cells [46], Arabidopsis [47], and rice [48]. Progress in targeting has led to guidelines for minimizing CRISPR/Cas9 off-target effects [49].…”