Genome editing is induced in a binary manner in single human cells

Takahashi, Gou; Kondo, Daisuke; Minato, Maeda; Morishita, Yoshitaka; Miyaoka, Yuichiro

doi:10.1016/j.isci.2022.105619

Cited by 2 publications

(8 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Amplification of off-target genomic regions and addition of adapters and indexes were conducted through two-step PCR. The library preparation was performed with the same protocol as the NGS analysis previously performed in our laboratory [ 16 ]. All libraries were mixed in 4 nM amounts and 20% PhiX Control v3 (illumina) was added for amplicon sequencing.…”

Section: Methodsmentioning

confidence: 99%

“…Fastq files generated by MiSeq were imported into the CLC Genomics Workbench (QIAGEN, Hilden, Germany) and adapter sequences were trimmed and demultiplexed using the index sequences. The data were analyzed by CRISPResso2 ( https://github.com/pinellolab/CRISPResso2 ) [ 17 ] in the CRISPResso Batch mode, described previously [ 16 ]. The assay background was negligible at less than 0.1% for all gRNAs ( S11 and S15 Tables).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Fusion of histone variants to Cas9 suppresses non-homologous end joining

Kato-Inui,

Takahashi,

Ono

et al. 2024

PLoS ONE

Self Cite

View full text Add to dashboard Cite

As a versatile genome editing tool, the CRISPR-Cas9 system induces DNA double-strand breaks at targeted sites to activate mainly two DNA repair pathways: HDR which allows precise editing via recombination with a homologous template DNA, and NHEJ which connects two ends of the broken DNA, which is often accompanied by random insertions and deletions. Therefore, how to enhance HDR while suppressing NHEJ is a key to successful applications that require precise genome editing. Histones are small proteins with a lot of basic amino acids that generate electrostatic affinity to DNA. Since H2A.X is involved in DNA repair processes, we fused H2A.X to Cas9 and found that this fusion protein could improve the HDR/NHEJ ratio by suppressing NHEJ. As various post-translational modifications of H2A.X play roles in the regulation of DNA repair, we also fused H2A.X mimicry variants to replicate these post-translational modifications including phosphorylation, methylation, and acetylation. However, none of them were effective to improve the HDR/NHEJ ratio. We further fused other histone variants to Cas9 and found that H2A.1 suppressed NHEJ better than H2A.X. Thus, the fusion of histone variants to Cas9 is a promising option to enhance precise genome editing.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Fusion of histone variants to Cas9 suppresses non-homologous end joining

Kato-Inui,

Takahashi,

Ono

et al. 2024

PLoS ONE

Self Cite

View full text Add to dashboard Cite

show abstract

“…We recommend using Lipofectamine 3000 for transfection of PC9 cells. 1 Alternatives: Other common lipofection reagents can be used for transfection. Lentiviral gene delivery can also potentially be used.…”

Section: Step-by-step Methods Detailsmentioning

confidence: 99%

“… 8 We have confirmed that this protocol works with HeLa cells and PC9 cells as well and have established more than 2,600 clones of these cultured human cells using the single particle isolation system (SPiS). 1 This protocol may also be applicable to Base Editing 9 , 10 , 11 and Prime Editing. 12 …”

Section: Before You Beginmentioning

confidence: 99%

“… 8 N/A Forword primer for genomic PCR and Sanger Sequence in RBM20 gene TGTGTGGTTCTGTAGAGTTGGGAGT In this paper N/A Reverse primer for genomic PCR and Sanger Sequence in RBM20 gene ATCCTGTCCCTCTTGTCATCTCC In this paper N/A Recombinant DNA pX458-HypaCas9 plasmid Takahashi et al. 1 https://www.addgene.org/Yuichiro_Miyaoka/ Addgene #190604 Software and algorithms Cas-Designer Park et al. 14 http://www.rgenome.net/cas-designer/ CRISPRdirect Naito et al.…”

Section: Key Resources Tablementioning

confidence: 99%

See 1 more Smart Citation