Genome assembly and annotation for red clover (<i>Trifolium pratense</i>; Fabaceae)

Ištvánek, Jan; Jaroš, Michal; Křenek, Aleš; Řepková, Jana

doi:10.3732/ajb.1300340

Cited by 60 publications

(73 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Therefore, many benefits of functional genomics and molecular breeding techniques are now accessible to forage crop breeders. Alfalfa, red clover, and white clover have described genetic linkage maps and partial genome sequences based on assembled contigs and scaffolds [51][52][53][54][55]. Contig mapping and gene annotation of these genomes has been aided by cDNA sequencing, and genomic synteny mapping using well defined legume genomes, such as M. truncatula [53,[55][56][57].…”

Section: The Potential Of Modern Genomic and Phenomic Tools To Develomentioning

confidence: 99%

Diurnal Leaf Starch Content: An Orphan Trait in Forage Legumes

et al. 2017

View full text Add to dashboard Cite

Abstract:Forage legumes have a relatively high biomass yield and crude protein content, but their grazed and harvested biomass lacks the high-energy carbohydrates required to meet the productivity potential of modern livestock breeds. Because of their low carbohydrate content, forage legume diets are typically supplemented with starch rich cereal grains or maize (Zea mays), leading to the disruption of local nutrient cycles. Although plant leaves were first reported to accumulate starch in a diurnal pattern over a century ago, leaf starch content has yet to be exploited as an agronomic trait in forage crops. Forage legumes such as red clover (Trifolium pratense) have the genetic potential to accumulate up to one third of their leaf dry mass as starch, but this starch is typically degraded at night to support nighttime growth and respiration. Even when diurnal accumulation is considered with regard to the time the crop is harvested, only limited gains are realized due to environmental effects and post-harvest losses from respiration. Here we present original data for starch metabolism in red clover and place it in the broader context of other forage legumes such as, white clover (T. repens), and alfalfa (Medicago sativa). We review the application of recent advances in molecular breeding, plant biology, and crop phenotyping, to forage legumes to improve and exploit a potentially valuable trait for sustainable ruminant livestock production.

show abstract

Section: The Potential Of Modern Genomic and Phenomic Tools To Develomentioning

confidence: 99%

Diurnal Leaf Starch Content: An Orphan Trait in Forage Legumes

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Slides with prepared chromosome spreads were subsequently used for FISH with rDNA probes. Probes for both 5S and 45S rDNA were derived from previously published T. pratense doi: 10.17221/115/2016-CJGPB sequencing data (Ištvánek et al 2014). Selected rDNA sequences were amplified using loci-specific primers (5S_F: GGTGCGATCATACCAGCACTAA, 5S_R: AGGTGCAACACAAGGACTTC, 45S_F: TTCCCACTGTCCCTGTCTACTAT, 45S_R: TTAC-GAGGTCCACCAACGGCA) by polymerase chain reaction (PCR) with a reaction mixture containing 1× GoTaq Reaction Buffer (Promega, Madison, USA), 0.2 mM dNTPs, 1 µm primers, 0.5 U Taq Polymerase (Promega) and 20 ng of gDNA.…”

Section: Plantmentioning

confidence: 99%

Impact of interspecific hybridization of T. pratense × T. medium and backcrossing on genetic variability of progeny

Dluhošová¹,

Řepková²,

Jakešová³

et al. 2016

CZECH J GENET PLANT

View full text Add to dashboard Cite

Dluhošová J., Řepková J., Jakešová H., Nedělník J. (2016): Impact of interspecific hybridization of T. pratense × T. medium and backcrossing on genetic variability of progeny. Czech J. Genet. Plant Breed., 52: 125-131.Red clover (Trifolium pratense L.) is a high-quality fodder crop which has been hybridized successfully with its wild relative zigzag clover (T. medium L.). The aim of this study was to evaluate the genetic impact of interspecific hybridization and subsequent repeated backcrossing on the variability within hybrid progeny genomes. Nuclear DNA content of 800 and 753 hybrid plants from F 7 /F 8 and F 8 /F 9 generations, respectively, was measured by flow cytometry. Resulting values were converted to estimated chromosome counts, which were successfully validated on a sample of 28 plants by counting mitotic chromosomes. The two generations showed a similar distribution of various chromosome counts ranging from 22 to 47 chromosomes. In total, 24.0% and 34.3% of plants from the two generations had different numbers of chromosomes from their parental plants. Variability within the hybrid population was assessed by fluorescent in situ hybridization using rDNA probes. Individual plants had a pattern of 5S and 45S rDNA loci rather more similar to that of T. pratense than of T. medium. Numbers of chromosomes with clusters of 5S rDNA ranged from 6 to 14 while those of 45S rDNA varied between 4 and 13. Individual arrangements were almost unique, and some plants possessed also novel formations which were not present in any of the parental species, such as a cluster of 5S rDNA surrounded by 45S rDNA clusters or a 45S rDNA cluster surrounded by 5S rDNA clusters. This suggests complex rearrangements connected with posthybridization stabilization of hybrid genomes.

show abstract

“…Considerable advances have recently been made in the development of genomic resources for the clover genus ( Trifolium ), with the publication of the genome assembly [5] and analyses of the transcriptome [6] of red clover ( T. pratense ). Subterranean clover ( Trifolium subterraneum ) is known to have an unusual plastid genome structure [7].…”

Section: Introductionmentioning

confidence: 99%

Evolutionary origin of highly repetitive plastid genomes within the clover genus (Trifolium)

Sveinsson

Cronk

2014

BMC Evol Biol

View full text Add to dashboard Cite

BackgroundSome clover species, particularly Trifolium subterraneum, have previously been reported to have highly unusual plastomes, relative to closely related legumes, enlarged with many duplications, gene losses and the presence of DNA unique to Trifolium, which may represent horizontal transfer. In order to pinpoint the evolutionary origin of this phenomenon within the genus Trifolium, we sequenced and assembled the plastomes of eight additional Trifolium species widely sampled from across the genus.ResultsThe Trifolium plastomes fell into two groups: those of Trifolium boissieri, T. strictum and T. glanduliferum (representing subgenus Chronosemium and subg. Trifolium section Paramesus) were tractable, assembled readily and were not unusual in the general context of Fabeae plastomes. The other Trifolium species (“core Trifolium”) proved refractory to assembly mainly because of numerous short duplications. These species form a single clade, which we call the “refractory clade” (comprising subg, Trifolium sections Lupinaster, Trifolium, Trichocephalum, Vesicastrum and Trifoliastrum). The characteristics of the refractory clade are the presence of numerous short duplications and 7-15% longer genomes than the tractable species. Molecular dating estimates that the origin of the most recent common ancestor (MRCA) of the refractory clade is approximately 13.1 million years ago (MYA). This is considerably younger than the estimated MRCA ages of Trifolium (c. 18.6 MYA) and Trifolium subg. Trifolium (16.1 MYA).ConclusionsWe conclude that the unusual repetitive plastome type previously characterized in Trifolium subterraneum had a single origin within Trifolium and is characteristic of most (but not all) species of subgenus Trifolium. It appears that an ancestral plastome within Trifolium underwent an evolutionary change resulting in plastomes that either actively promoted, were permissive to, or were unable to control, duplications within the genome. The precise mechanism of this important change in the mode and tempo of plastome evolution deserves further investigation.Electronic supplementary materialThe online version of this article (doi:10.1186/s12862-014-0228-6) contains supplementary material, which is available to authorized users.

show abstract

Genome assembly and annotation for red clover (Trifolium pratense; Fabaceae)

Abstract: The presented red clover genomic data constitute a resource for improvement through molecular breeding and for comparison to other sequenced plant species.

Cited by 60 publications

References 70 publications

Diurnal Leaf Starch Content: An Orphan Trait in Forage Legumes

Diurnal Leaf Starch Content: An Orphan Trait in Forage Legumes

Impact of interspecific hybridization of T. pratense × T. medium and backcrossing on genetic variability of progeny

Evolutionary origin of highly repetitive plastid genomes within the clover genus (Trifolium)

Contact Info

Product

Resources

About