Genetic structure of the European polecat (Mustela putorius) and its implication for conservation strategies

Abstract

During the last century, the European polecat Mustela putorius populations in most of Europe declined and survived in fragmented patches, because of habitat alterations and direct persecution. To assess the genetic consequences of the demographic decline and to describe the spatial pattern of genetic diversity, 250 polecats sampled at seven localities from five European countries -Poland, Denmark (southern Denmark and northern Denmark), Spain, Belgium (eastern and western) and the Netherlands -were screened by means of nine microsatellite loci. Genetic diversity estimated by mean expected heterozygosity (H E ) and allelic richness (AR) were moderately high within populations [range: 0.50 (northern Denmark) H E 0.64 (Poland) and 1.33 AR 7.80] as compared with other carnivores and mustelids. Bottleneck tests suggested that polecat populations in southern Denmark and Poland have declined recently and populations from northern Denmark and the Netherlands have expanded recently, whereas the remaining populations did not show any sign of demographic change. Recent demographic changes could suggest that some of the populations are still not in equilibrium, which could partly explain the relatively high genetic variability observed in polecat populations despite the drastic decline in population size observed in several European countries. A significant heterozygote deficiency [F IS = 0.19; 0.01 95% confidence interval (CI) 0.32] suggests substructuring within the total European sample. Partitioning of the genetic variation among sampling locations (F ST = 0.14; 0.06 95% CI 0.23) and pairwise F ST between localities (range: 0.01 F ST 0.37) without any correlation with the geographic distances between localities were found, suggesting a recent divergence and a restriction of gene flow between populations and the action of genetic drift. An assignment test showed that the Polish and the northern Danish populations were the most unique, whereas the other populations were partially admixed. Factorial component analysis tests indicate a subdivision of the total sample into two distinct groups: one including the samples from Poland and the two Danish localities and the second group comprising the remaining localities investigated. The observed pattern of genetic differentiation is suggested to be due to two main routes of recolonization after the last glacial period. To compare the results obtained with microsatellite data, the most variable region of the mitochondrial DNA (d-loop) was sequenced and different phylogenetic reconstructions and genetic diversity analyses based on nucleotide (p) and haplotype diversity (h) measures within populations were performed using a subsample of populations. The lack of well-defined geographical structure, as well as the reduced level of mitochondrial DNA variability (p: 0.00274 AE 0.00038; h: 0.876 AE 0.028) that was found, has been previously reported in several studies on different carnivores and supports the hypothesis of post-glacial recolonization from southern or eastern refugees of ...

The genetic legacy of the 19th‐century decline of theBritish polecat: evidence for extensive introgression from feral ferrets

“…The observed pattern of mtDNA diversity, with a moderate level of haplotype diversity but notably higher nucleotide diversity than other polecat populations across continental Europe (Pertoldi et al . ), is compatible with a scenario of secondary contact between lineages (Grant & Bowen ). In support of this hypothesis, preliminary mtDNA and microsatellite data on polecats and ferrets from mainland Europe also suggest that HPG I is typical of ferrets and very rare in nonintrogressed polecats (M. Costa & C. Fernandes, unpublished data).…”

“…Haplotype diversity in the overall British polecat population ( h = 0.6108) was lower than observed in other polecat populations across mainland Europe, whereas nucleotide diversity ( π = 0.00735) was considerably higher ( h = 0.876, π = 0.00274; Pertoldi et al . ).…”

“…The British polecat has a lower genetic variation than other polecat populations across Europe, which have higher allelic richness and expected heterozygosity ( A R = 3.39–3.89, H E = 0.50–0.64; Pertoldi et al . ). Such comparisons need to account for ascertainment bias and differences in the number and type of microsatellite loci used.…”

“…However, Pertoldi et al . () used only loci isolated in other mustelid species and still found higher levels of population genetic variation. Previous studies (Paetkau et al .…”

Phylogeography of the forest-dwelling European pine marten (Martes martes): new insights into cryptic northern glacial refugia

“…The mitochondrial DNA region selected in this study includes the final part of the cytochrome b gene, tRNAPro , tRNAThr , the control region ( d ‐loop), and the initial part of 12S rRNA used in a previous work on genetic variability of the European polecat, Mustela putorius Linnaeus, 1758, in Europe (Pertoldi et al ., ). This fragment of ∼ 1600 bp in length was amplified using the forward primer LutbF (5′‐AGAACACCCATTCATCATTATCG‐3′) and the reverse primer LLU12SH91 (5′‐CTAGAGGGATGTAAAGCA CCG‐3′) (Pertoldi et al ., ).…”