Genetic Separation of Purine Transport from Phosphoribosyltransferase Activity in Salmonella typhimurium

Benson, Charles E.; Hornick, David L.; Gots, Joseph S.

doi:10.1099/00221287-121-2-357

Cited by 5 publications

(5 citation statements)

References 6 publications

(10 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Benson et al (3) have shown that the transport of guanine into the cells is not mediated by guanine phosphoribosyltransferase, but by the product of the guaP gene, which appears to be a guanine-specific permease. A similar transport system is believed to exist for adenine and hypoxanthine (3). In strains containing a functional purine nucleoside phosphorylase, purine deoxynucleosides have the same repressive effect on the pur genes as the corresponding bases.…”

Section: Resultsmentioning

confidence: 99%

“…No purine excretion could be detected by cross-feeding when the cells harbored only one of the mutations, hpt or gpt. This is probably due to the overlapping specificities of the two phosphoribosyltransferases towards hypoxanthine and guanine (3). The presence of a deoD mutation in the hpt or gpt strains elevates the basal level of the purine biosynthetic enzymes.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Role of hypoxanthine and guanine in regulation of Salmonella typhimurium pur gene expression

Houlberg¹,

Jensen²

1983

J Bacteriol

View full text Add to dashboard Cite

Data are presented which indicate that the repression of pur gene expression seen after the addition of preformed purines to cultures of Salmonella typhimurium is the consequence of the presence or the formation of the purine bases, hypoxanthine and guanine. This conclusion is based on the following observations. First, it was impossible to find a correlation between the size of any individual purine nucleotide pool and the level of the first four enzymes in the de novo biosynthetic pathway. Second, adenine plus guanosine served as a perfect source of purine nucleotides, but their presence caused no repression of pur gene expression if the cells lacked purine nucleoside phosphorylase activity. This enzyme is needed to convert adenine and guanosine to hypoxanthine and guanine, but not for their conversion to nucleotides. Third, addition of guanine to a strain lacking guanine phosphoribosyltransferase (gpt) resulted in a repression of the level of the purine de novo biosynthetic enzymes, a reduction of the growth rate, and a fall in the pools of ATP and GTP. Addition of hypoxanthine to a strain lacking hypoxanthine phosphoribosyltransferase (hpt) had a similar, although weaker, effect. If the cells lacked both hypoxanthine and guanine phosphoribosyltransferases (hpt gpt), their basal level of the purine de novo biosynthetic enzymes was repressed in minimal medium. Such cells grow slower than wild-type cells and excrete purines, probably due to the inability to salvage endogenously formed hypoxanthine and guanine.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

Role of hypoxanthine and guanine in regulation of Salmonella typhimurium pur gene expression

Houlberg¹,

Jensen²

1983

J Bacteriol

View full text Add to dashboard Cite

show abstract

“…There is evidence for purine base permeases (2,7), and BLAST analysis shows that this upstream open reading frame shares significant alignment with a xanthinespecific purine permease in B. subtilis (5). Thus a purine base permease, possibly having specificity for guanine, and the gene encoding guanine deaminase are found in proximity within the E. coli genome.…”

mentioning

confidence: 99%

Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase

2000

View full text Add to dashboard Cite

Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST) Guanine deaminase (EC 3.5.4.3) is an aminohydrolase responsible for the conversion of guanine to xanthine and ammonia. This reaction is one of two, the other being guanylate reductase, which removes the guanine base from the pool of guanine-containing metabolites. As such, these enzymes may under certain circumstances play a role in the regulation of cellular GTP and the guanylate nucleotide pool. The levels of GMP reductase increase with increasing concentrations of guanine in cultures of Escherichia coli and Salmonella enterica serovar Typhimurium (3, 12), thereby allowing guanylate to serve as a substrate for the synthesis of adenine nucleotides. Conversely, the synthesis of the enzymes IMP dehydrogenase and GMP synthetase (guaA and guaB), which convert IMP, the terminal product of the de novo purine pathway, to GMP, are both repressed when wild-type cultures of E. coli are supplemented with guanine (9, 12). Guanine and hypoxanthine have subsequently been shown to be corepressors for purR (10,14), which regulates transcription of the operons required for de novo purine synthesis and the synthesis of AMP and GMP from IMP (11,16).,The human cDNA corresponding to guanine deaminase (GenBank AF095286) was recently cloned, sequenced, and demonstrated to be part of a family of amino-and amidohydrolases that share a heavy metal binding motif associated with zinc or manganese (15). In the present work, we have identified a putative E. coli gene corresponding to the human guanine deaminase cDNA using the Basic Local Alignment Search Tool (BLAST) (1). Expression and kinetic analyses have verified the identity of the corresponding bacterial gene to be a previously identified open reading frame of unassigned function.Strategy for the identification of E. coli guanine deaminase. BLAST analysis of the E. coli genome (accession no., U00096) for homology to the protein sequence corresponding to the human cDNA for guanine deaminase revealed a homologous open reading frame of 1,317 nucleotides. This functionally unassigned gene at map position 65.2 min encompasses nucleotides 3023787 to 3025106 of the E. coli genome. The putative gene encodes a 439-residue protein having a predicted molecular mass of 50,244 Da that is similar to the human gene product for guanine deaminase of 51,040 Da (15).Amplification, expression, purification, and characterization of the putative E. coli guanine deaminase. The putative E. coli guanine deaminase sequence was amplified by PCR using primers ED1 (5ЈGGGGAATTCATGATGTCAGGAGAACA CA) and ED2 (5ЈTGGATGTTAAAGCTTTATTA) based on the E. coli sequence. PCR was performed with 5 min of denaturation at 95°C prior to the first cycle, followed by 1 min of annealing (52°C), 1 min of polymerization (72°C), and 1 min of denaturation (94°C) for 30 cycles using vent DNA polymerase (New England Biolabs) and DNA prepared from E. coli strain MG1655 (CGSC strain n...

show abstract

“…Cells were removed from a growing culture, filtered, and washed in AB medium and resuspended in the growth medium lacking pyrimidines. The optical density at 436 nm was measured before addition of [2][3][4][5][6][7][8][9][10][11][12][13][14] C]uracil (50 Ci/mol) or [2-14 C]cytosine (50 Ci/mol). Cell suspension (200 l) was filtered through 0.45-m-pore-size nitrocellulose filters and was subsequently washed with 2.0 ml of AB medium.…”

mentioning

confidence: 99%

“…Complementation of uraA mutations was always done in a two-step manner: (i) test of growth rate on uracil as a pyrimidine source and (ii) uptake analysis. Determination of uracil uptake was done by measuring [2][3][4][5][6][7][8][9][10][11][12][13][14] C]uracil (New England Nuclear) uptake in exponentially growing cells at room temperature. Cells were removed from a growing culture, filtered, and washed in AB medium and resuspended in the growth medium lacking pyrimidines.…”

mentioning

confidence: 99%

Uracil uptake in Escherichia coli K-12: isolation of uraA mutants and cloning of the gene

et al. 1995

View full text Add to dashboard Cite

Mutants defective in utilization of uracil at low concentrations have been isolated and characterized. The mutations in question (uraA) map close to the upp gene encoding uracil phosphoribosyltransferase. By complementation analysis, a plasmid that complements the uraA mutation has been isolated. The uraA gene was shown to be the second gene in a bicistronic operon with upp as the promoter proximal gene. The nucleotide sequence of the gene was determined, and the gene encodes a hydrophobic membrane protein with a calculated M r of 45,030. The UraA protein has been identified in sodium dodecyl sulfate-polyacrylamide gels in the membrane fraction of minicells harboring the uraA plasmids.

show abstract

Genetic Separation of Purine Transport from Phosphoribosyltransferase Activity in Salmonella typhimurium

Cited by 5 publications

References 6 publications

Role of hypoxanthine and guanine in regulation of Salmonella typhimurium pur gene expression

Role of hypoxanthine and guanine in regulation of Salmonella typhimurium pur gene expression

Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase

Uracil uptake in Escherichia coli K-12: isolation of uraA mutants and cloning of the gene

Contact Info

Product

Resources

About