Genetic Polymorphisms in Long Noncoding RNA H19 Are Associated With Susceptibility to Breast Cancer in Chinese Population

Abstract

H19, a maternally expressed imprinted gene transcribing a long noncoding RNA, has previously been reported to be involved in tumorigenesis and cancer progression. However, the association between the H19 polymorphisms and breast cancer (BC) susceptibility has remained elusive. The aim of this study was to evaluate the associations between 2 H19 haplotype tagging SNPs (rs3741219 T>C, rs217727 C>T) and the risk of breast cancer.Our study comprised 464 BC patients and 467 cancer-free controls in China. rs3741219 and rs217727 were genotyped with polymerase chain reaction-restriction fragment-length polymorphism (PCR-RFLP) and created restriction site PCR (CRS-RFLP) assays, respectively. False-positive report probability (FPRP) was calculated to test the false-positive association.On performing univariate analysis, no significant association between H19 polymorphisms (rs3741219 and rs217727) and BC was observed. However, in further stratified analyses, CT+TT genotypes of rs217727 had a significantly lower risk of breast cancer among women with number of pregnancy >2 (OR = 0.79; 95% CI = 0.55–0.97). CT genotype of rs217727 was associated with ER positivity (OR = 2.19; 95 % CI = 1.07–4.45) and HER-2 positivity (OR = 1.34; 95 % CI = 1.05–2.12). It was proved that our results were less likely to be false positives according to false-positive report probability calculation.Our findings extend available data on the association of H19 polymorphisms and BC susceptibility. Further validation in large population or cohort studies is needed.

The effects of placental long noncoding RNA H19 polymorphisms and promoter methylation on H19 expression in association with preeclampsia susceptibility

“…The polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP) and amplification refractory mutation system were used for the detection of rs3741219 T>C, rs217727 C>T and rs2107425 C>T polymorphisms as described previously . The details of primers are presented in Table …”

Association of the study between LncRNA‐H19 gene polymorphisms with the risk of breast cancer

“…For determination of genotype frequencies of two lncRNA‐H19 gene polymorphisms, we used PCR‐RFLP method and the following sequence of forward and reverse primers: 5´‐CCCCCTGCGGCGGACGGTTG‐3´ and 5´‐GGCGTAATGGAATGCTTCAA‐3´ for lncRNA‐H19 ( rs3741219) polymorphism, and 5´‐ACTCACGAATCGGCTCTGGAAGGTG‐3´ and 5´‐ATGTGGTGGCTGGTGGTCAACGGT‐3´ for lncRNA‐H19 (rs217727) polymorphism …”

“…According to the evidence, it suggests that genetic changes in lncRNA‐H19 play an important role in cancer development . To date, few studies have attempted to reveal the association between lncRNA‐H19 gene polymorphism with the risk of BC . According to the previous findings, we assume that two SNPs in lncRNA‐H19 may be related to the risk of BC in Iranian.…”

“…12,13 To date, few studies have attempted to reveal the association between lncRNA-H19 gene polymorphism with the risk of BC. 16,17 According to the previous findings, we assume that two SNPs in lncRNA-H19 may be related to the risk of BC in Iranian. However, the relationship between lncRNA-H19 polymorphism and BC remained unclear.…”

High lncRNA H19 expression as prognostic indicator: data mining in female cancers and polling analysis in non-female cancers

“…H19 is a highly abundant, conserved, and imprinted lncRNA [6] that is overexpressed in several cancers and acts as an oncogene [7], promoting tumorigenesis and cancer progression [8, 9]. The upregulation of H19 forebodes an unfavorable prognosis in lung cancer [10], gastric cancer [11, 12], renal cell carcinoma [13], colorectal cancer [14], and gallbladder carcinoma [15].…”