Genetic loss-of-function of activating transcription factor 3 but not C-type lectin member 5A prevents diabetic peripheral neuropathy

Abstract

We investigated the mediating roles of activating transcription factor 3 (ATF3), an injury marker, or C-type lectin member 5A (CLEC5A), an inflammatory response molecule, in the induction of endoplasmic reticulum (ER) stress and neuroinflammation in diabetic peripheral neuropathy in ATF3 and CLEC5A genetic knockout (aft3−/− and clec5a−/−, respectively) mice. ATF3 was expressed intranuclearly and was upregulated in mice with diabetic peripheral neuropathy (DN) and clec5a−/− mice. The DN and clec5a−/− groups also exhibited neuropathic behavior, but not in the aft3−/− group. The upregulation profiles of cytoplasmic polyadenylation element-binding protein, a protein translation–regulating molecule, and the ER stress-related molecules of inositol-requiring enzyme 1α and phosphorylated eukaryotic initiation factor 2α in the DN and clec5a−/− groups were correlated with neuropathic behavior. Ultrastructural evidence confirmed ER stress induction and neuroinflammation, including microglial enlargement and proinflammatory cytokine release, in the DN and clec5a−/− mice. By contrast, the induction of ER stress and neuroinflammation did not occur in the aft3−/− mice. Furthermore, the mRNA of reactive oxygen species–removing enzymes such as superoxide dismutase, heme oxygenase-1, and catalase were downregulated in the DN and clec5a−/− groups but were not changed in the aft3−/− group. Taken together, the results indicate that intraneuronal ATF3, but not CLEC5A, mediates the induction of ER stress and neuroinflammation associated with diabetic neuropathy.

The Antinociceptive Potential of Camellia japonica Leaf Extract, (−)-Epicatechin, and Rutin against Chronic Constriction Injury-Induced Neuropathic Pain in Rats

“…ATF3 has been implicated as a marker of nerve injury and can be characterized as an ‘adaptive response’ gene for cells to cope with extra-and intracellular changes. ATF3 expression is upregulated in chemotherapy-and surgery-induced neuropathic pain [ 53 , 54 ], and ATF3-deletion mice showed decreased mechanical allodynia in diabetic peripheral neuropathy [ 55 ]. Another transcription factor, c-Jun, the best-known substrate of JNK, was considered as a hub protein and a key gene that may play an important role in the development of neuropathic pain.…”

Nonpermissive Skin Environment Impairs Nerve Regeneration in Diabetes via Sec31a

“…SensiFAST SYBR Lo‐ROX Mix (Bioline, Memphis, TN) was used to perform quantitative polymerase chain reaction (qPCR) following the manufacturer's protocol on QuantoStudio 3 (Applied Biosystems, Waltham, MA). Reverse transcription‐qPCR (RT‐qPCR) procedures followed protocols as previously described 23 . The gene‐specific primer sequences (5′‐3′) used for RT‐qPCR are listed below: TGFβ1, forward‐ CCATTC CTGGCGATACCTCAG and reverse‐ GCACAACTCCGGTGACATCAA; CTGF, forward‐ AATGCTGCGAGGAGTGGGT and reverse‐ CGGCTCTAATCATAGTTGGGTCT; PDGF‐C, forward‐ TTCTTGGCAAGGCTTTTGTT and reverse‐ TGCTTGGGACACATTGACAT; PDGF‐D, forward‐ GTGGAGGAAATTGTGGCTGT and reverse‐ CGTTCATGGTGATCCAACTG; GAPDH, forward‐ CCAGGTGGTCTCCTCTGACTTC and reverse‐ CACCCTGTTGCTGTAGCCAAA.…”

“…Reverse transcription-qPCR (RT-qPCR) procedures followed protocols as previously described. 23 The gene-specific primer sequences (5 0 -3 0 ) used for RT-qPCR are listed below: TGFβ1, forward-CCATTC CTGGCGATACCTCAG and reverse-GCACAACTCCGGTG ACATCAA; CTGF, forward-AATGCTGCGAGGAGTGGGT and reverse-CGGCTCTAATCATAGTTGGGTCT; PDGF-C, forward-TTCTTGGCAAGGCTTTTGTT and reverse-TGCTTGGGACACATTGACAT; PDGF-D, forward-GTGGAGG AAATTGTGGCTGT and reverse-CGTTCATGGTGATC CAACTG; GAPDH, forward-CCAGGTGGTCTCCTCTG ACTTC and reverse-CACCCTGTTGCTGTAGCCAAA.…”

SEPT9 Upregulation in Satellite Glial Cells Associated with Diabetic Polyneuropathy in a Type 2 Diabetes-like Rat Model

“…The molecular expression profiles on the fourth- and fifth-lumbar DRGs were assessed using a regular immunofluorescence approach, as described in our previous study [ 5 ]. In the present study, the primary antisera were anti-SEPT9 (rabbit, 1:100; Proteintech, Rosemont, IL, USA) and anti-non-phosphorylated neurofilament (mouse, 1:1000; Biolegend, San Diego, CA, USA).…”

“…Of these complications, diabetic polyneuropathy (DPN) is the most common, affecting approximately 30% of patients with diabetes [ 1 ] who exhibit prominent and early neuropathic manifestations such as paresthesia and chronic pain [ 2 , 3 ]. Studies have focused on the molecular alterations of the dorsal root ganglia (DRG), particularly on intracellular signaling mechanisms underlying such alterations [ 4 , 5 ]. Regarding morphology, the degeneration of DRG nerve terminals (i.e., the intraepidermal nerve fibers [IENFs]) is a major pathological characteristic of DPN.…”