Genetic diversity of Oecomys (Rodentia, Sigmodontinae) from the Tapajós River basin and the role of rivers as barriers for the genus in the region

The emergence of a new sex-system (XX/XY1Y2) suggests a species complex in the “monotypic” rodent Oecomys auyantepui (Rodentia, Sigmodontinae)

“…A more detailed phylogenetic analysis of the genus Oecomys was already proposed 48 . Thus, in this work we focused on O. auyantepui and representatives of each Oecomys species/clade recognized in the literature 48 , 49 , 51 (Supplementary Table 1 ). The genus Oecomys was recovered as monophyletic in the topologies obtained with the Cytochrome b (Cytb) dataset, the Cytochrome C Oxidase Subunit I (COI) dataset, and with the concatenated dataset (Cytb + beta-​fibrinogen intron 7 [FGB-I7]), with high support values recorded only in the Bayesian Inference (BI) analyses (Figs.…”

“…We used partial nucleotide sequences of the mitochondrial genes Cytochrome b (Cytb; 801 base pairs) and Cytochrome C Oxidase Subunit I (COI; 657 base pairs), and sequence data from nuclear beta-​fibrinogen intron 7 (FGB-I7; 727 base pairs). We followed the protocols described in 49 for the extraction, amplification, and sequencing of Cytb and FGB-I7 genes; we also followed the same protocols for the COI gene, with the primers Fish F2 (TCGACTAATCATAAAGATATCGGCAC) and Fish R2 (ACTTCAGGGTGACCGAAGAATCAGAA) 84 . The sequences obtained in the present study are available on GenBank under accession numbers OM927735, OM927739, OM927737 (CN285); OM927736, OM927740, OM927738 (LTO05) (see Supplementary Table 1 ).…”

“…We also used the sequences available on Genbank ( http://www.ncbi.nlm.nih.gov/genbank ) from the three genes in order to include all COI sequences available in this database for O. auyantepui (48 sequences) plus representative COI sequences of Oecomys species (14 sequences), totaling 64 sequences in our COI analysis; all Cytb sequences available for O. auyantepui (nine sequences) plus representative Cytb sequences of each Oecomys species/clade previously recognized 48 , 49 , 51 (43 sequences), totaling 52 sequences in our Cytb analysis; and all FGB-I7 sequences available for O. auyantepui (two sequences) plus representative FGB-I7 sequences of each Oecomys species/clade recognized 48 , 51 ) (15 sequences), totaling 19 sequences in our concatenated data analysis (Cytb + FGB-I7) (Supplementary Table 1 ). Euryoryzomys nitidus , Hylaeamys megacephalus and Oligoryzomys utiaritensis were used as outgroup for Cytb and concatenated analyses, and one sequence of H. megacephalus for COI analysis (Supplementary Table 1 ).…”

Karyotypic divergence reveals that diversity in the Oecomys paricola complex (Rodentia, Sigmodontinae) from eastern Amazonia is higher than previously thought

“…The role of Amazonian rivers as a barrier to species distribution was proposed by Wallace [ 38 ]. Since then, many studies in terrestrial vertebrates as rodents, primates and birds have shown that the more significant rivers of the Amazon basin can act as allopatric barriers to gene flow and contribute to species diversification in Amazonia [ 6 , 20 , 37 , 39 , 40 ]. This could explain the morphological differences found between the eastern and western clades of the “ paricola group” mentioned by Suárez-Villota et al [ 4 ], as differences in craniodental measurements, pelage coloration and morphology of the incisive foramen and subsquamosal fenestra, since the former clade occurs in the Belém and Xingu areas of endemism, while the latter occurs in the Tapajós area of endemism [ 4 , 37 ] ( Fig 5 ).…”

“…The arboreal genus Oecomys (Rodentia, Sigmodontinae) currently comprises 18 recognized species distributed from southern Central America to southeastern Brazil in South America, and is the most speciose genus of the Oryzomyini tribe. However, the actual number is uncertain, considering that morphological, phylogenetic (mtDNA and nuDNA), classic cytogenetics and chromosome painting analyses have shown that there is wide-ranging diversity within some lineages [ 1 – 6 ]. Although these multidisciplinary approaches have helped researchers to comprehend better the distribution range and taxonomy of Oecomys , the resolution of O .…”