Genetic Diversity of Banana Bunchy Top Virus (BBTV) Prevalent in Assam Causing Banana Bunchy Top Disease

Kakati, Nilakshi; Nath, Palash Deb

doi:10.20546/ijcmas.2018.711.178

Cited by 1 publication

(1 citation statement)

References 12 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The LAMP assay takes advantage of high strand displacement activity of nuclease-free water and stored at -20 before testing. The forty test samples along with one healthy sample were subjected to a conventional PCR for confirmation using a set of standard primer that amplifies a region of the coat protein in DNA3 of BBTV genome (Kakati and Nath, 2018;Baldodiya et al, 2019). PCR primers used were: BBTV-DNA3 forward primer (5' ATCAAGAAGAGGCGGGTTGG 3') and BBTV-DNA3 reverse primer (5' GGATTTCTTCGGA TACCTAGCCAT 3').…”

Section: Resultsmentioning

confidence: 99%

Real-Time loop-mediated isothermal amplification assay for rapid detection of Banana bunchy top virus in North-east India

Kaushik¹,

Halabi²,

Barua³

et al. 2022

JEB

View full text Add to dashboard Cite

Aim: The study aims to standardize a Real-Time LAMP assay for effective, highly sensitive, and rapid detection of BBTV in North-east India. Methodology: Forty samples of banana showing BBTV like symptoms were collected from Assam, India and subjected to conventional PCR for confirmation. Six sets of BBTV LAMP primers were designed and the PCR positive samples were subjected to Real-Time LAMP assay for detection of BBTV. Finally, a sensitivity test of BBTV LAMP assay and comparison of BBTV LAMP assay with conventional PCR was done using seven 10-fold dilutions of total genomic DNA of leaf samples with the highest dilution starting from 100 ng µl-1. Results: Initially a total of twenty six out of forty banana samples were tested positive for BBTV with conventional PCR method. The Real-Time LAMP assay for BBTV detection resulted in typical sigmoidal amplification curves with the peak values ranging between 8.00 to 12.15 min and annealing derivatives ranging between 83.3oC to 84.3oC in the tested samples. Sensitivity testing and comparison of BBTV Real-Time LAMP assay with conventional PCR revealed that the BBTV LAMP assay could efficiently detect up to 0.0001ng µl-1 of total DNA against 0.01ng µl-1 in conventional PCR. Interpretation: The findings highlight rapid, sensitive, accurate and effective diagnosis of BBTV using Real-Time LAMP method. This method can be preferred over conventional diagnostic techniques like PCR or ELISA for rapid large scale detection of BBTV in banana plants in North-east India. Key words: Banana, Banana bunchy top virus, Rapid detection, Real-Time LAMP assay

show abstract

Section: Resultsmentioning

confidence: 99%