Genetic characterization of mouse immunoglobulin allotypic determinants (allotopes) defined by monoclonal antibodies

Huang, Chun-Ming; Parsons, Marilyn; Oi, Vernon T.; Huang, Huei-Jen Su; Herzenberg, Leonard A.

doi:10.1007/bf00372464

Cited by 32 publications

(15 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The VJ light chain and VDJ heavy chain variable genes were amplified by polymerase chain reaction using as templates the plasmids containing genomic DNA of the anti-mouse IgG2a a, d, e, f, g, h, j, n, o monoclonal Ab (a kind gift of Mark Shlomchik) derived from the 20.8.3 hybridoma (25). To generate a single chain Ab gene a PCR sewing approach was taken using the following oligonucleotide primers: primer 1 (5′V L ) 5′- TCGCGA ATCGCCGACAGGTGCGATGGACATGAGGGCCCATGCTC-3′; primer 2 (3′V L ) 5′- CCTCCCGAGCCACCGCCTCCGCTGC CTCCGCCTCCCCGTTTTATTTCCAACTTCGTCCCG-3′; primer 3 (5′V H ) 5′- GCAGCGGAGGCGGTGGCTCGGGAGG CGGAGGCTCGCAGGTACAGCTGAAAGAGTCAGG-3′; primer 4 (3′V H ) 5′- CCCGGG TTTCTGGGGGCTGTTGTTTCAGCTGAGGAGAC.…”

Section: Methodsmentioning

confidence: 99%

Deletion of IgG-Switched Autoreactive B Cells and Defects in Faslpr Lupus Mice

Aït-Azzouzene

Kono

Gonzalez-Quintial

et al. 2010

The Journal of Immunology

View full text Add to dashboard Cite

During a T cell-dependent antibody (Ab) response, B cells undergo Ab class-switching and variable region hypermutation, with the latter process potentially rendering previously innocuous B cells autoreactive. Class switching and hypermutation are temporally and anatomically linked with both processes dependent on the enzyme, activation-induced deaminase, and occurring principally, but not exclusively, in germinal centers. To understand tolerance regulation at this stage, we generated a new transgenic (Tg) mouse model expressing a membrane-tethered γ2a-reactive superantigen (γ2a-macroself Ag) and assessed the fate of emerging IgG2a-expressing B cells that have, following class switch, acquired self-reactivity of its Ag receptor to the macroself-Ag. In normal mice, self-reactive IgG2a-switched B cells were deleted, leading to the selective absence of IgG2a memory responses. These findings identify a novel negative selection mechanism for deleting mature B cells that acquire reactivity to self-Ag. This process was only partly dependent on the Bcl-2 pathway, but markedly inefficient in MRL-Faslpr lupus mice, suggesting that defective apoptosis of isotype-switched autoreactive B cells is central to Fas mutation-associated systemic autoimmunity.

show abstract

Section: Methodsmentioning

confidence: 99%

Deletion of IgG-Switched Autoreactive B Cells and Defects in Faslpr Lupus Mice

Aït-Azzouzene

Kono

Gonzalez-Quintial

et al. 2010

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…The IgG1 anti-DNP (dinitrophenyl) mAb and Texas Red-avidin were the gifts of Dr. R. Hardy (Genetics Dept., Stanford University, Palo Alto, CA). Antibodies 8.3, reactive with Igh-la, and 21-48.3, reactive with Igh-la, 3a, are as described (22).…”

Section: Methodsmentioning

confidence: 99%

Importance of immunoglobulin isotype in human antibody-dependent, cell-mediated cytotoxicity directed by murine monoclonal antibodies.

Kipps¹,

Parham²,

Punt³

et al. 1985

The Journal of Experimental Medicine

218

View full text Add to dashboard Cite

Using the fluorescence activated cell sorter to select rare IgG2a- and IgG2b-producing variants, we developed switch variant families of hybridomas from IgG1-producing hybridomas, ME1 and MA2.1. The IgG2a and IgG2b antibodies produced by such switch variants have the same binding activities for HLA as the IgG1 antibodies produced by the parent hybridomas. Using these antibodies, we directly compared the IgG1, IgG2a, and IgG2b murine Ig isotypes for their capacities to direct human peripheral blood lymphocytes (PBL) in antibody-dependent cell-mediated cytotoxicity (ADCC) against a B lymphoblastoid cell line. We demonstrate that, for antibodies of identical binding affinity and specificity, the murine IgG2a isotype is the most effective in directing ADCC by human effector cells. The murine IgG2b directs intermediate levels of ADCC activity while IgG1 is inactive. We identified the effector cells in human PBL that mediate IgG2a or IgG2b ADCC as nonadherent killer (K) cells. These cells express the C3bi receptor and have cytolytic activity which is specifically blocked by a monoclonal antibody (anti-Leu-11a) that binds the Fc receptor (FcR) of such cells. Finally, FcR-bearing K cells bind to target cell-bound, rather than free, IgG2a or IgG2b molecules.

show abstract

“…Antibody-producing hybridoma cell lines were generated as described (17). Two hybridoma clones, TD-1 and TD-2, were isolated, both of which secreted high titers of antibodies against esterase D.…”

Section: Methodsmentioning

confidence: 99%

Purification, biochemical characterization, and biological function of human esterase D.

Lee¹,

Wheatley²,

Benedict³

et al. 1986

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Human esterase D (carboxylesterase; carboxylic-ester hydrolase, EC 3.1.1.1), a genetic marker of retinoblastoma, was purified to biochemical homogeneity from erythrocytes. The purification scheme including carboxymethylcellulose, phenyl-Sepharose, chromatofocusing, and hydroxylapatite chromatographies resulted in a 10,000-fold purification of the enzyme with 15% recovery of total activity. The Km of esterase D was estimated to be 10 x 10-6 M using 4-methylumbelliferyl acetate as substrate. (8,9). In addition, the defective gene of Wilson disease was found to be linked to the esterase D gene (10). Thus, it is important to investigate the nature of the esterase D protein and its gene so as to understand these inherited disorders.Esterase D has been found in most tissues, but not much is known about its structure and function. A protocol for partial purification of this enzyme has been described (11).However, it remains difficult to obtain a sufficient amount of the homogeneous enzyme and to generate specific antibodies. In this communication, we describe the purification and characterization of this enzyme as well as the preparation of esterase D-specific polyclonal and monoclonal antibodies. Furthermore, we observed that this enzyme was mainly distributed in liver and kidney and could be induced by treatment with phenobarbital but not with phorbol ester. MATERIALS AND METHODSEsterase D Enzymatic Assays. (i) Quantitative assay. Esterase D activity was determined essentially as described (11). The reaction was started by adding the enzyme into 1 ml of reaction buffer containing 50 mM potassium phosphate, 1 mM EDTA (pH 6.0), with 0.1 mM 4-methylumbelliferyl acetate as substrate. The increase in absorbance at 340 nm was recorded. A unit of activity was defined as the amount of enzyme that hydrolyzed 1 /.kmol of substrate per min at 230C using 7.27 mM-1 cm-1 as the coefficient of absorption.(ii) Spot test. A rapid semiquantitative test was developed by us for assaying enzyme activity in column fractions.Briefly, 5 jul of 4-methylumbelliferyl acetate (20 Ag/ml) in sodium acetate (pH 5.2) was spotted onto a piece of SaranWrap over a UV transilluminator together with 5 A.l of enzyme samples from each column fraction. The intensity of fluorescence emitted corresponded with the enzyme activity.(iii) Qualitative assay. Electrophoresis in 1% agarose gels was performed as described (12) with slight modifications. The agarose gel buffer was a 1:5 dilution ofrunning buffer that contained 62 mM Tris, 15.5 mM citric acid, 18 mM boric acid, and 1.65 mM lithium hydroxide (pH 7.5). Electrophoresis was performed at 40C for 90 min at 20 V/cm. The gel was stained in 50 ml of 50 mM sodium acetate (pH 5.2) containing 1.0 ml of 4-methylumbelliferyl acetate (1 mg/ml in acetone) for 5 min and then photographed under UV light.Purification of Human Esterase D.Step 1. Outdated human erythrocytes were washed once in phosphate-buffered saline (PBS) with 1 mM EDTA. A precooled (-20°C) mixture of chloroform and butanol was added to the pa...

show abstract

Genetic characterization of mouse immunoglobulin allotypic determinants (allotopes) defined by monoclonal antibodies

Cited by 32 publications

References 19 publications

Deletion of IgG-Switched Autoreactive B Cells and Defects in Faslpr Lupus Mice

Deletion of IgG-Switched Autoreactive B Cells and Defects in Faslpr Lupus Mice

Importance of immunoglobulin isotype in human antibody-dependent, cell-mediated cytotoxicity directed by murine monoclonal antibodies.

Purification, biochemical characterization, and biological function of human esterase D.

Contact Info

Product

Resources

About