Genetic Basis of Melanin Pigmentation in Butterfly Wings

Abstract

Despite the variety, prominence, and adaptive significance of butterfly wing patterns, surprisingly little is known about the genetic basis of wing color diversity. Even though there is intense interest in wing pattern evolution and development, the technical challenge of genetically manipulating butterflies has slowed efforts to functionally characterize color pattern development genes. To identify candidate wing pigmentation genes, we used RNA sequencing to characterize transcription across multiple stages of butterfly wing development, and between different color pattern elements, in the painted lady butterfly Vanessa cardui. This allowed us to pinpoint genes specifically associated with red and black pigment patterns. To test the functions of a subset of genes associated with presumptive melanin pigmentation, we used clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 genome editing in four different butterfly genera. pale, Ddc, and yellow knockouts displayed reduction of melanin pigmentation, consistent with previous findings in other insects. Interestingly, however, yellow-d, ebony, and black knockouts revealed that these genes have localized effects on tuning the color of red, brown, and ochre pattern elements. These results point to previously undescribed mechanisms for modulating the color of specific wing pattern elements in butterflies, and provide an expanded portrait of the insect melanin pathway.

Transcriptome analysis reveals evolutionary co-option of neural development and signaling genes for the wing pigmentation pattern of the polka-dotted fruit fly

“…In wings of the butterflies (Vanessa caudui and Heliconius spp. ), another Yellow family protein gene, yellow-d, was upregulated at red pigmentation areas compared with black pigmentation areas [38,40]. Our results together with these previously reported studies suggest that these Yellow protein family genes might play a role in inhibiting melanin pigmentation.…”

“…melanogaster [20,28,36]. Association of these genes with melanin pigmentation patterns was also reported in other insects [22,37,38]. Therefore it was not surprising to detect these three genes in the present study.…”

Whole-chromosome hitchhiking driven by a male-killing endosymbiont

“…The three main alleles correspond to the three common forewing phenotypes, so we term these BC chrysippus (orange background with black forewing tip, formerly bbcc), BC dorippus (orange without black tip, formerly bbCC), and BC orientis (brown background with black forewing tip, formerly BBcc) ( Fig 2C). [36] and yellow knockouts in other butterflies show reduced melanin pigmentation [37], making this a compelling candidate for the background colour polymorphism. The strongest associations with forewing tip (C locus) occur at the gene arrow, and a phylogenetic network for a 100 kb region around this gene similarly clusters individuals by phenotype (S5 Fig).…”

A practical guide to CRISPR/Cas9 genome editing in Lepidoptera

“…No genome reference was available for V. cardui when we first began our experiment, so we used a transcriptome assembly 18 to identify sequences of the Ddc coding region. Primers GCCAGATGATAAGAGGAGGTTAAG and GCAGTAGCCTTTACTTCCTCCCAG were designed to amplify and sequence the target region of the genome, and exon-intron boundaries were inferred by comparing genomic and cDNA sequences.…”