Genetic and Functional Diversity among Fluorescent Pseudomonads Isolated from the Rhizosphere of Banana

Naik, P. Ravindra; Sahoo, Nirakar; Goswami, Devrishi; Ayyadurai, Niraikulam; Sakthivel, Natarajan

doi:10.1007/s00248-008-9368-9

Cited by 55 publications

(46 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The genomic DNA from these bacteria was extracted using phenol chloroform method after incubating them in Zobell Marine Broth for 24 h [20]. PCR amplification of almost the full length of the 16S rDNA was performed with the template DNA using the universal forward and reverse primers 5'GAGTTTGATCCTGGCTCA3' and 5'ACGGCTAACTTGTTACGACT3' respectively [21].…”

Section: Isolation and Identification Of Bacteria From Biofilmmentioning

confidence: 99%

Biodegradation of Starch Blended High Density Polyethylene using Marine Bacteria Associated with Biofilm Formation and its Isolation Characterization

Muthukumar¹

2014

J Microb Biochem Technol

View full text Add to dashboard Cite

The biofouling and biodegradation of starch blended high density polyethylene (HDPE) was studied by immersing it in Bay of Bengal (India) for a period of six months. A positive correlation was observed amongst the various constituents in the biofilm. FTIR spectrum showed the formation of C-O stretching band and decrease in ester and keto carbonyl bands indicating biodegradation. 17% weight loss was observed, while the polymer surface turned hydrophilic. Twenty two bacterial strains were isolated from the biofilm and biochemically characterized. 16sRNA sequence analysis was performed for three strains. In vitro biodegradation of the polymer exposed to sunlight for 150 days incubated with the isolated pure strain (Exiguobacterium) and combination of two strains (Exiguobacterium and B. subtilis) for 75 days, showed a gravimetric weight loss of 4.7 and 12.1% respectively indicating synergy between the two organisms. The current study indicated, the isolated microorganisms could degrade starch blended HDPE.

show abstract

Section: Isolation and Identification Of Bacteria From Biofilmmentioning

confidence: 99%

Biodegradation of Starch Blended High Density Polyethylene using Marine Bacteria Associated with Biofilm Formation and its Isolation Characterization

Muthukumar¹

2014

J Microb Biochem Technol

View full text Add to dashboard Cite

show abstract

“…fulva has been isolated from banana rhizospheric soil (19). In addition, together with P. putida, it has been the most frequently isolated species in rice seed samples obtained from provinces in the Philippines (31).…”

mentioning

confidence: 99%

First Case of Human Infection Due to Pseudomonas fulva , an Environmental Bacterium Isolated from Cerebrospinal Fluid

et al. 2010

View full text Add to dashboard Cite

We report the first case of human infection due to Pseudomonas fulva. P. fulva caused acute meningitis following the placement of a drainage system in a 2-year-old female. Additionally, the isolate displayed a VIM-2 carbapenemase in a class 1 integron context. CASE REPORTA 2-year-old female was brought to our center after 30 days of treatment in another center due to a history of fever, malaise, and partial food rejection. A sample of urine was taken for a bacteriological culture, and empirical treatment with amoxicillin was begun. The urinalysis showed pathological sediment with more than 25 leukocytes per field, pyuria, and bacteriuria. The urinary culture yielded Ͼ10 5 CFU of Proteus penneri per ml. Based on the susceptibility test result, amoxicillin was discontinued and a 1-week course of trimethoprimsulfamethoxazole (TMP-SMX) therapy was prescribed. Since she did not recover, she was hospitalized in the same center for evaluation. After 48 h, she presented a poor general state with signs of meningismus. Therapy with ceftriaxone (150 mg/kg/ day) was started. A computerized axial tomography (CAT) test, performed after lumbar puncture, revealed ventricular dilatation. The cerebrospinal fluid (CSF) cytochemical analysis was normal, and the CSF culture was negative.Due to a torpid evolution and because the patient presented facial paralysis, she was referred to Ricardo Gutierrez Children's Hospital, where a new brain CAT was performed showing progressive hydrocephalus. In order to drain the CSF, an external catheter was placed in the lateral ventricle. A presumptive diagnosis of meningitis with a bad evolution or tuberculous meningitis was made. Empirical treatment with vancomycin (60 mg/kg/day) (intravenous [i.v.]), cefotaxime (220 mg/kg/day) (i.v.), and tuberculostatic drugs (isoniazid, 5 mg/ kg/day; rifampin, 10 mg/kg/day; streptomycin, 15 mg/kg/day; pyrazinamide, 20 mg/kg/day) was started. Since the lumbar puncture was traumatic, CSF chemistry and cell count were not carried out; however, the CSF culture obtained by lumbar puncture (for bacteria, fungi, and mycobacteria) was negative.After 9 days of having the catheter drainage in place, the patient showed no neurological sign improvement. The catheter was changed, and a CSF sample for bacterial culture was taken with negative results. The CSF cell count was 8 leukocytes/mm 3 , and protein and glucose contents were 17 mg/dl and 70 mg/dl, respectively. Vancomycin was suspended, and the patient continued with ceftriaxone, and despite a negative result for the detection of Mycobacterium tuberculosis by PCR, the patient continued on tuberculosis drugs until the culture was finished.As indicated by neurosurgery, a nuclear magnetic resonance test was carried out, showing a lesion that occupied the midbrain and pons consistent with a probable ependymoma.On the eighth day after the new drainage system was placed, the patient was in very poor condition; therefore, internal ventriculoperitoneal shunting and performing a brain biopsy of the mass were considered. A new...

show abstract

“…Now-a-days a variety of molecular based methods are used for characterization and identification of bacteria. These includes amplified ribosomal DNA restriction analysis (ARDRA) , random amplified polymorphic DNA (RAPD) (Sikora et al, 1997), repetitive extragenic palindromic elements (REP) (Naik et al, 2008) and 16-23S intergenic spacer . Keeping all these points in view, the objective of the present study was to study the diazotrophic diversity in rhizospheric soil of wheat-based cropping systems of Punjab to ascertain soil health and fertility.…”

Section: Introductionmentioning

confidence: 99%

Molecular characterization of diazotrophic bacteria isolated from rhizosphere of wheat cropping system from central plain region of Punjab

Neemisha¹,

Vikal²

2014

Afr. J. Microbiol. Res.

View full text Add to dashboard Cite

Soil is a hot spot for microbial diversity, however, the excessive use of agrochemicals have reduced natural microflora of soil. Soil samples were collected from central plain region of Punjab and georeferenced. Physicochemical properties of the soil samples ranged from 5.9-8.7 (pH), 0.13-0.51 dSm -1 electrical conductivity (EC), 0.26 -0.77% organic carbon (OC), 14 -119 ppm (ammonical N) and 28 -119 ppm (nitrate N). Variable diazotrophic population was obtained on eight different nitrogen free media. Diazotrophic count was found to be positively affected by OC; whereas, it was negatively affected by pH, EC, ammonical and nitrate nitrogen. A total of 169 diazotrophs were isolated and characterized using cultural, morphological and biochemical techniques and tentatively identified as diverse genera of Pseudomonas sp., Bacillus sp., Azotobacter sp., Rhizobium sp., Azospirillum sp., Beijerinckia sp. and Derxia sp. Using molecular techniques, sixty seven isolates were found to be positive for amplification of nif H. Based on unweighted pair group method with arithmetic mean (UPGMA) clustering, dendrogram was obtained and the representative cultures were identified as Xanthomonas sp., Beijerinckia indica, Flavobacterium johnsoniae, Pseudoxanthomonas suwonensis, Lysinibacillus sphaericus, Stenotrophomonas maltophilia and Pseudomonas aeruginosa.

show abstract

Genetic and Functional Diversity among Fluorescent Pseudomonads Isolated from the Rhizosphere of Banana

Cited by 55 publications

References 43 publications

Biodegradation of Starch Blended High Density Polyethylene using Marine Bacteria Associated with Biofilm Formation and its Isolation Characterization

Biodegradation of Starch Blended High Density Polyethylene using Marine Bacteria Associated with Biofilm Formation and its Isolation Characterization

First Case of Human Infection Due to Pseudomonas fulva , an Environmental Bacterium Isolated from Cerebrospinal Fluid

Molecular characterization of diazotrophic bacteria isolated from rhizosphere of wheat cropping system from central plain region of Punjab

Contact Info

Product

Resources

About