Genetic Ablation of Soluble TNF Does Not Affect Lesion Size and Functional Recovery after Moderate Spinal Cord Injury in Mice

Ellman, Ditte Gry; Degn, Matilda; Lund, Minna Christiansen; Clausen, Bettina Hjelm; Novrup, Hans Gram; Flæng, Simon Bertram; Jørgensen, Louise Helskov; Suntharalingam, Lujitha; Svenningsen, Åsa Fex; Brambilla, Roberta; Lambertsen, Kate Lykke

doi:10.1155/2016/2684098

Cited by 12 publications

(27 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…TNF mainly exists in two biologically active forms, a membraneanchored form (mTNF) and a soluble form (solTNF), and the biological effects of them are mediated through binding of TNF receptor 1 (TNFR1) and TNFR2 (Probert, 2015). However, the role of TNF in SCI are controversial (Ellman et al, 2016). G.M.…”

Section: Discussionmentioning

confidence: 99%

Signatures of altered long noncoding RNAs and messenger RNAs expression in the early acute phase of spinal cord injury

Shi

Ning

Zhang

et al. 2018

Journal Cellular Physiology

View full text Add to dashboard Cite

Spinal cord injury (SCI) is a highly severe disease and it can lead to the destruction of the motor and sensory function resulting in temporary or permanent disability. Long noncoding RNAs (lncRNAs) are transcripts longer than 200 nt that play a critical role in central nervous system (CNS) injury. However, the exact roles of lncRNAs and messenger RNAs (mRNAs) in the early acute phase of SCI remain to be elucidated. We examined the expression of mRNAs and lncRNAs in a rat model at 2 days after SCI and identified the differentially expressed lncRNAs (DE lncRNAs) and differentially expressed mRNAs (DE mRNAs) using microarray analysis. Subsequently, a comprehensive bioinformatics analysis was also performed to clarify the interaction between DE mRNAs. A total of 3,193 DE lncRNAs and 4,308 DE mRNAs were identified between the injured group and control group. Classification, length distribution, and chromosomal distribution of the dysregulated lncRNAs were also performed. The gene ontology analysis and Kyoto Encyclopedia of Genes and Genomes enrichment analysis were performed to identify the critical biological processes and pathways. A protein−protein interaction (PPI) network indicated that IL6, TOP2A, CDK1, POLE, CCNB1, TNF, CCNA2, CDC20, ITGAM, and MYC were the top 10 core genes. The subnetworks from the PPI network were identified to further elucidate the most significant functional modules of the DE mRNAs. These data may provide novel insights into the molecular mechanism of the early acute phase of SCI. The identification of lncRNAs and mRNAs may offer potential diagnostic and therapeutic targets for SCI.

show abstract

Section: Discussionmentioning

confidence: 99%

Signatures of altered long noncoding RNAs and messenger RNAs expression in the early acute phase of spinal cord injury

Shi

Ning

Zhang

et al. 2018

Journal Cellular Physiology

View full text Add to dashboard Cite

show abstract

“…Interestingly, genetic ablation of sTNF did not reduce lesion size and improve functional recovery after moderate SCI in mice (Ellman et al, 2016). In contrast, epidural administration of XPro1595 to the contused spinal cord decreased anxiety-related behavior, and reduced neuronal damage at the site of injury resulting in improved locomotor function, whereas central administration of the non-selective anti-TNF drug etanercept had no therapeutic effects (Novrup et al, 2014).…”

Section: Selective Neutralization Of Stnf By Dominant-negative Tnf Mumentioning

confidence: 97%

Selective Targeting of TNF Receptors as a Novel Therapeutic Approach

Fischer

Kontermann

Pfizenmaier

2020

Front. Cell Dev. Biol.

151

146

View full text Add to dashboard Cite

Tumor necrosis factor (TNF) is a central regulator of immunity. Due to its dominant proinflammatory effects, drugs that neutralize TNF were developed and are clinically used to treat inflammatory and autoimmune diseases, such as rheumatoid arthritis, inflammatory bowel disease and psoriasis. However, despite their clinical success the use of anti-TNF drugs is limited, in part due to unwanted, severe side effects and in some diseases its use even is contraindicative. With gaining knowledge about the signaling mechanisms of TNF and the differential role of the two TNF receptors (TNFR), alternative therapeutic concepts based on receptor selective intervention have led to the development of novel protein therapeutics targeting TNFR1 with antagonists and TNFR2 with agonists. These antibodies and bio-engineered ligands are currently in preclinical and early clinical stages of development. Preclinical data obtained in different disease models show that selective targeting of TNFRs has therapeutic potential and may be superior to global TNF blockade in several disease indications.

show abstract

“…DNA was extracted from biopsies from 3-4 weeks old mice as previously described [13,20]. Genotyping was performed using PCR and the following primers for LysM Cre Tnf fl/fl and Tnf fl/fl mice: LysM1 (5 -CTTGGGCTGCCAGAATTTCTC), LysM2 (5 -TTACAGTCGGCCAGGCTGAC), Cre8 (5 -CCCAGAAATGCCAGATTACG), TNF KO41 (5 -TGAGTCTGTCTTAACTAACC), and TNF KO42 (5 CCCTTCATTCTCAAGGCACA) [19,20].…”

Section: Genotypingmentioning

confidence: 99%

“…However, the data are conflicting with one study demonstrating that TNFR1 deficient mice display decreased lesion size and improved motor function [6] and another demonstrating increased lesion size and worse functional outcome [7]. Surprisingly, germ-line ablation of TNF in Tnf −/− mice [12] and genetic ablation of tmTNF in mTNF ∆/∆ mice [13] did not affect lesion size and functional outcome after SCI. Despite this, anti-TNF treatment in SCI has shown promising results [14][15][16][17][18].…”

Section: Introductionmentioning

confidence: 99%

Conditional Ablation of Myeloid TNF Improves Functional Outcome and Decreases Lesion Size after Spinal Cord Injury in Mice

Ellman

Lund

Nissen

et al. 2020

Cells

Self Cite

View full text Add to dashboard Cite

Spinal cord injury (SCI) is a devastating condition consisting of an instant primary mechanical injury followed by a secondary injury that progresses for weeks to months. The cytokine tumor necrosis factor (TNF) plays an important role in the pathophysiology of SCI. We investigated the effect of myeloid TNF ablation (peripheral myeloid cells (macrophages and neutrophils) and microglia) versus central myeloid TNF ablation (microglia) in a SCI contusion model. We show that TNF ablation in macrophages and neutrophils leads to reduced lesion volume and improved functional outcome after SCI. In contrast, TNF ablation in microglia only or TNF deficiency in all cells had no effect. TNF levels tended to be decreased 3 h post-SCI in mice with peripheral myeloid TNF ablation and was significantly decreased 3 days after SCI. Leukocyte and microglia populations and all other cytokines (IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, and IFNγ) and chemokines (CCL2, CCL5, and CXCL1) investigated, in addition to TNFR1 and TNFR2, were comparable between genotypes. Analysis of post-SCI signaling cascades demonstrated that the MAPK kinase SAPK/JNK decreased and neuronal Bcl-XL levels increased post-SCI in mice with ablation of TNF in peripheral myeloid cells. These findings demonstrate that peripheral myeloid cell-derived TNF is pathogenic in SCI.

show abstract

Genetic Ablation of Soluble TNF Does Not Affect Lesion Size and Functional Recovery after Moderate Spinal Cord Injury in Mice

Cited by 12 publications

References 44 publications

Signatures of altered long noncoding RNAs and messenger RNAs expression in the early acute phase of spinal cord injury

Signatures of altered long noncoding RNAs and messenger RNAs expression in the early acute phase of spinal cord injury

Selective Targeting of TNF Receptors as a Novel Therapeutic Approach

Conditional Ablation of Myeloid TNF Improves Functional Outcome and Decreases Lesion Size after Spinal Cord Injury in Mice

Contact Info

Product

Resources

About