Generation of Human Monoclonal Allergen-Specific IgE and IgG Antibodies from Synthetic Antibody Libraries

Abstract

Background: Allergen-specific IgE and IgG antibodies play pivotal roles in the induction and progression of allergic hypersensitivity reactions. Consequently, monoclonal human IgE and IgG4 antibodies with defined specificity for allergens should be useful in allergy research and diagnostic tests. We used combinatorial antibody libraries and subsequent recombinant production to make and assess IgE, IgG1, and IgG4 allergen-specific antibodies. Methods: We used phage display to select a synthetic single-chain antibody fragment (scFv) library against 3 different allergens, from bee venom, bovine milk, and apple. The scFv obtained were converted into IgG1, IgG4, and IgE antibody formats and assessed for their biochemical properties by ELISA, immunoblotting, and fluorescence-activated cell sorting. Results: Two different antibody formats for each IgG1, IgG4, and IgE antibody were produced in mammalian cells as disulfide-linked and glycosylated Ig, which were usable in allergen-specific ELISA assays and immunoblots. In addition, the recombinant IgE antibodies mediated the binding of allergens to HEK-293 cells transfected with the high-affinity IgE receptor, and this binding was blocked by corresponding IgG antibodies. Conclusions: The use of synthetic libraries for the generation of allergen-specific recombinant IgE and IgG

A tool kit for rapid cloning and expression of recombinant antibodies

“…Free light or heavy chain was not detected, suggesting that the antibody chains are assembled into whole antibody molecules. The molecular sizes corresponding to the heavy and light chains suggest the secreted antibodies are properly folded and glycosylated2930. Similar results were obtained when assessing the IgG 2 , IgG 3 , IgA 1 and IgA 2 isotypes under reducing conditions, with protein bands corresponding to the heavy chains (50–60 kDa) and light chains at 25 kDa (Figure 5).…”

“…Although these facilitate expression of a large number of mAbs in a short time, in our experience, the transient co-transfection of separate vectors doubles the DNA preparation work, requires maxi or mega plasmid purifications and large amount of transfection reagent for the production of milligrams of antibody, which is a costly, labor- and time-intensive scale-up process. This limitation has been addressed by the generation of vectors hosting a dual antibody expression cassette with a selection marker293031. However, all these antibody cloning systems rely on restriction enzyme- and ligation-dependent cloning methods, which adds an additional cost, prevents high-throughput analysis of antibody candidates, and may sometimes be impractical due to the lack of compatible restriction sites.…”

Identification, Recombinant Expression, and Characterization of the 100 kDa High Molecular Weight Hymenoptera Venom Allergens Api m 5 and Ves v 3

“…In contrast to mammalian systems, insect cells most likely will provide similar glycosylation to that found in the natural isoforms, a fact that is supported by the apparent molecular masses of the expressed recombinant allergens (35). The identity of the expressed open reading frames with the venom proteins was further proven by a recombinant human IgE mAb specific for Api m 5 selected by phage display (27). This anti-Api m 5 IgE mAb reacted to a similar extent with the natural venom isoforms and the insect cell-expressed isoforms of Api m 5 and Ves v 3, suggesting the presence of a conserved protein epitope in Ves v 3 and Api m 5 (Fig.…”

“…The recombinant venom allergens Ves v 5 were cloned, expressed, and purified according to established procedures (17). The chimeric human IgE Ab against Api m 5 was generated essentially as described recently (27).…”

Close-up of the Immunogenic α1,3-Galactose Epitope as Defined by a Monoclonal Chimeric Immunoglobulin E and Human Serum Using Saturation Transfer Difference (STD) NMR

“…Homodimeric IgG1 and IgE and heterotetrameric IgE immunoglobulins were produced using recently established vector systems (24). The variable regions VH and VL were amplified using oligonucleotides containing restriction sites at the 5Ј and 3Ј termini of the VH (gatcatttaaatgtgtccagtgtgaggtgaaactggag and gatcgtcgaccccgagacagtgacagaagttcc) and VL (gatccctgcagggtgccagatgtgatgtggtgatgacac and gatcggcgcgcccacagtccgtttgatttcgag) by PCR, respectively, in such a way that a 4ϫ His tag is generated at the C-terminal end of the heavy chain.…”