Generation of a Soluble African Horse Sickness Virus VP7 Protein Capable of Forming Core-like Particles

Abstract

A unique characteristic of the African horse sickness virus (AHSV) major core protein VP7 is that it is highly insoluble, and spontaneously forms crystalline particles in AHSV-infected cells and when expressed in vitro. The aggregation of AHSV VP7 into these crystals presents many problems in AHSV vaccine development, and it is unclear whether VP7 aggregation affects AHSV assembly or contributes to AHSV pathogenesis. Here, we set out to abolish VP7 self-assembly by targeting candidate amino acid regions on the surface of the VP7 trimer via site-directed mutagenesis. It was found that the substitution of seven amino acids resulted in the complete disruption of AHSV VP7 self-assembly, which abolished the formation of VP7 crystalline particles and converted VP7 to a fully soluble protein still capable of interacting with VP3 to form core-like particles. This work provides further insight into the formation of AHSV VP7 crystalline particles and the successful development of AHSV vaccines. It also paves the way for future research by drawing comparisons with similar viral phenomena observed in human virology.

Investigating the Role of African Horse Sickness Virus VP7 Protein Crystalline Particles on Virus Replication and Release

“…To construct reverse genetics plasmids that encode the mutant soluble VP7 (sVP7), the In-Fusion cloning strategy [ 42 ] was used to introduce mutations into segment 7 (S7) cDNA. To construct AHSV4-sVP7 transcription plasmid, the plasmid vector pJAD-S7 [ 67 ], containing a cDNA copy of AHSV4 S7 (GenBank KM820855) was used as template.…”

“…To construct AHSV4-sVP7 transcription plasmid, the plasmid vector pJAD-S7 [ 67 ], containing a cDNA copy of AHSV4 S7 (GenBank KM820855) was used as template. A dsDNA fragment of the VP7 backbone (position 827 to 1017) containing the mutations that encode the seven amino acid substitutions (underlined in gBlock sequence) responsible for converting AHSV VP7 into a soluble protein, i.e., P276H; R328A; V333N; A334P; P335M; V336P; and Q338P [ 42 ] was designed and synthesised using gBlock Gene Fragments (Integrated DNA Technologies, Coralville, IA, USA) (5′-ATGCGTATGTCTCTC A CACTTGGCACGCATTACGCGCTGTCATTTTTCAGCAGATGAATATGCAGCCTATTAATCCGCCGATTTTTCCACCGACTGAAAGGAATGAAATTGTTGCGTATCTATTAGTAGCTTCTTTAGCTGATGTGTATGCGGCTTTGAGACCAGATTTC GCG ATGAATGGTGTT AATC CG ATGCC AGG G C C GATTAACAGAGCTCT-3′). This dsDNA fragment was inserted into the pJAD-S7 backbone using the In-Fusion ® HD Cloning kit (Clontech ® , Takara Bio Inc., Shiga, Japan) cloning strategy.…”

“…Investigating the contribution of AHSV proteins to virulence is therefore a topic of great importance [ 41 ]. It has been previously suggested that the hallmark AHSV VP7 crystalline particles present in infected cells could possibly contribute to AHSV cellular pathogenesis [ 42 ]. Many viruses induce cellular remodelling during infection which results in the formation of such insoluble aggregates or inclusions that usually contain viral structural proteins [ 43 ].…”

“…In this study, we examined the role of AHSV VP7 crystalline particles on AHSV replication kinetics. We have recently reported on the discovery of seven amino acid substitutions that convert AHSV VP7 into a fully soluble protein, which does not self-assemble into the characteristic crystalline particles and is homogenously distributed throughout the cell when expressed in vitro [ 42 ]. It was also found that this soluble version of AHSV VP7 could interact with VP3 and self-assemble into empty core-like particles (CLPs) more efficiently than wild-type AHSV.…”

“…It was also found that this soluble version of AHSV VP7 could interact with VP3 and self-assemble into empty core-like particles (CLPs) more efficiently than wild-type AHSV. Furthermore, sequence analysis revealed that crystalline particle formation is likely conserved among all nine AHSV serotypes [ 42 ].…”