Generation of a monkey-tropic human immunodeficiency virus type 1 carrying env from a CCR5-tropic subtype C clinical isolate

Abstract

Several derivatives of human immunodeficiency virus type 1 (HIV-1) that evade macaque restriction factors and establish infection in pig-tailed macaques (PtMs) have been described. These monkey-tropic HIV-1s utilize CXCR4 as a co-receptor that differs from CCR5 used by most currently circulating HIV-1 strains. We generated a new monkey-tropic HIV-1 carrying env from a CCR5-tropic subtype C HIV-1 clinical isolate. Using intracellular homologous recombination, we generated an uncloned chimeric virus consisting of at least seven types of recombination breakpoints in the region between vpr and env. The virus increased its replication capacity while maintaining CCR5 tropism after in vitro passage in PtM primary lymphocytes. PtM infection with the adapted virus exhibited high peak viremia levels in plasma while the virus was undetectable at 12-16 weeks. This virus serves as starting point for generating a pathogenic monkey-tropic HIV-1 with CCR5-tropic subtype C env, perhaps through serial passage in macaques.

Generation of a neutralization-resistant CCR5 tropic simian/human immunodeficiency virus (SHIV-MK38) molecular clone, a derivative of SHIV-89.6

“…The titration was performed with TZM-bl cells for in vitro assays and with C8166-CCR5 cells for the in vivo inoculation experiment. The titration procedure with TZM-bl cells was performed as described previously (Otsuki et al, 2014). The procedure involving C8166-CCR5 cells was performed by limiting dilution.…”

“…AMD3100 was purchased from Sigma-Aldrich. The procedure for inhibition assays was performed as described previously (Otsuki et al, 2014). Inhibitors were diluted threefold from 4 to 0.005 mM in this study.…”

Induction of neutralizing antibodies against tier 2 human immunodeficiency virus 1 in rhesus macaques infected with tier 1B simian/human immunodeficiency virus

“…PCR was performed as follows: one cycle of denaturation (94 °C for 2 min), 30 cycles of amplification (98 °C for 10 s, 52 °C for 30 s, and 68 °C for 90 s) and a final extension (68 °C for 10 min) using KOD Plus Neo buffer, 0.2 mM dNTPs, 15 µM primers, 0.02 U of KOD Plus NEO (Toyobo Co., Ltd, Osaka, Japan), and a template. Approximately 5.5 kb of the env -deleted region from pcDNA3.1-SHIVMNA [ 57 ] (pcDNA3.1-SHIV-MNA env was generated by InFusion cloning using the pcDNA3.1 vector and SHIV-MNA env PCR product) was amplified by PCR using the primers SHenv7F (GGGACAGTATATGAATACTCC) and IFrevR (ATAGGAGATGCCTAAGGC). PCR was performed as follows: 1 cycle of denaturation (94 °C, 2 min), 30 cycles of amplification (98 °C for 10 s, 52 °C for 30 s, and 68 °C for 3 min), and a final extension (68 °C, 10 min).…”

CXCR4- and CCR5-Tropic HIV-1 Clones Are Both Tractable to Grow in Rhesus Macaques

“…(B) Kinetics of plasma viral loads in rhesus macaques inoculated with CXCR4-tropic MN4/LSDQgtu or CCR5-tropic gtu + A4CI1. Rhesus macaques MM581, MM602, and MM631 were infected with cell-free viruses obtained from transfected 293T cells, and monitored for viral RNAs in plasma as previously described ( Otsuki et al, 2014 ; Ishida et al, 2016 ). MM581 and MM602 were inoculated intravenously with 4.3 × 10 5 TCID 50 of MN4/LSDQgtu as determined in a macaque cell line HSC-F ( Akari et al, 1999 ).…”