Generation of a Highly Reactive Chicken-Derived Single-Chain Variable Fragment against Fusarium verticillioides by Phage Display

Abstract

Fusarium verticillioides is the primary causal agent of Fusarium ear and kernel rot in maize, producing fumonisin mycotoxins that are toxic to humans and domestic animals. Rapid detection and monitoring of fumonisin-producing fungi are pivotally important for the prevention of mycotoxins from entering into food/feed products. Chicken-derived single-chain variable fragments (scFvs) against cell wall-bound proteins from F. verticillioides were isolated from an immunocompetent phage display library. Comparative phage enzyme-linked immunosorbant assays (ELISAs) and sequencing analyses identified four different scFv antibodies with high sensitivity. Soluble antibody ELISAs identified two highly sensitive scFv antibodies, FvCA3 and FvCA4, with the latter being slightly more sensitive. Three-dimensional modeling revealed that the FvCA4 may hold a better overall structure with CDRH3, CDRL1 and CDRL3 centered in the core region of antibody surface compared with that of other scFvs. Immunofluorescence labeling revealed that the binding of FvCA4 antibody was localized to the cell walls of conidiospores and hyphae of F. verticillioides, confirming the specificity of this antibody for a surface target. This scFv antibody was able to detect the fungal mycelium as low as 10−2 μg/mL and contaminating mycelium at a quantity of 10−2 mg/g maize. This is the first report that scFv antibodies derived from phage display have a wide application for rapid and accurate detection and monitoring of fumonisin-producing pathogens in agricultural samples.

Detection of human pathogenicFusariumspecies in hospital and communal sink biofilms by using a highly specific monoclonal antibody

“…Furthermore, these studies have often employed Fusarium‐ selective media that eliminate other fungi present in polymicrobial communities (Short et al ., ). While monoclonal antibodies (mAbs) and antibody fragments have been developed for detecting and differentiating Fusarium species in vitro or in planta (Wong et al ., ; Arie et al ., ; Danks et al ., ; Hayashi et al ., ; Hu et al ., ), no attempts have been made to use mAbs to track human pathogenic strains in environmental samples. Jensen et al .…”

Determination of Aspergillus pathogens in agricultural products by a specific nanobody-polyclonal antibody sandwich ELISA

“…The rescued phages were applied to phage ELISA with 1 mg mL −1 antigens as previously described 32 . Plasmid DNAs from the positive clones were extracted and sequenced using the primer gback (GCCCCCTTATTAGCGTTTGCCATC).…”

Recombinant antibodies for diagnostics and therapy against pathogens and toxins generated by phage display

“…Cryptosporidium parvum , Plasmodium falciparum , or Toxoplasma gondii and fungi such as Aspergillus fumigatus . Not only human pathogens have been in the focus of antibody generation, but also veterinary pathogens like Myxobolus rotundus (a fish pathogen) or Babesia gibsoni (a dog pathogen) and plant pathogens like Aspergillus niger , Fusarium verticilloides , or Sclerotinia sclerotiorum .…”

“…Most antibodies generated in these studies derive from human antibody gene libraries, but libraries from mouse , chicken , camel , or macaque origin have been also successfully applied in phage display to generate monoclonal antibodies against eukaryotic pathogens.…”