Gene Structure and M20T Polymorphism of theSchistosoma mansoni Sm14 Fatty Acid-binding Protein

Abstract

The Schistosoma mansoni Sm14 antigen belongs to the fatty acid-binding protein family and is considered a vaccine candidate against at least two parasite worms, Fasciola hepatica and S. mansoni. Here the genomic sequence and the polymorphism of Sm14 have been characterized for the first time. We found that the conserved methionine at position 20 is polymorphic, being exchangeable with threonine (M20T). To evaluate the function of the amino acid residue at this position, we have also constructed the mutant Sm14-A20 besides the two native isoforms (Sm14-M20 and Sm14-T20). The three purified recombinant His 6 -tagged Sm14 proteins (rSm14-M20, rSm14-T20, and rSm14-A20) present a predominant ␤-barrel structure as shown by CD spectroscopy. Thermal and urea unfolding studies evidenced a higher structural stability of rSm14-M20 over the other forms (rSm14-M20>rSm14-T20>rSm14-A20). All of the Sm14 proteins were able to bind 11-(dansylamino)undecanoic acid (DAUDA) without substantial difference in the binding affinity. However, rSm14-M20 exhibited a higher affinity for natural fatty acids than the rSm14-T20 and rSm14-A20 proteins as judged by competitive experiments against DAUDA (rSm14-M20>rSm14-T20> rSm14-A20). The rSm14-M20 or rSm14-T20 isoforms but not the rSm14-A20 mutant was able to induce significant protection against S. mansoni cercariae challenge in immunized mice. The level of protection efficacy correlates with the extent of structure stability of the recombinant Sm14 isoforms and mutant.

A high-copy T7 Escherichia coli expression vector for the production of recombinant proteins with a minimal N-terminal His-tagged fusion peptide

“…This facilitates further plasmid manipulation for subcloning, sequencing and, in theory, a higher gene dosage that could result in a larger amount of recombinant protein expression, although this was not observed in the case of Fc of tetanus toxin. Successful expression of several other proteins was also achieved using this plasmid (14)(15)(16). Furthermore, pAE possesses a multiple cloning site after the His-tag region that facilitates subcloning of the desired insert.…”

A Newly Identified Leptospiral Adhesin Mediates Attachment to Laminin

“…PCR fragments corresponding to LIC10009 and LIC12906 genes were cloned into the pGEM T-Easy vector (Promega) and transformed into E. coli DH5␣. Following digestion with restriction enzymes (XhoI/HindIII for LIC10009 and XhoI/NcoI for LIC12906), fragments were subcloned into the E. coli expression vector pAE, which has been previously described (2,36). All constructs were verified by DNA sequencing with appropriate vector-specific primers.…”

Sm14 of Schistosoma mansoni in Fusion with Tetanus Toxin Fragment C Induces Immunoprotection against Tetanus and Schistosomiasis in Mice

“…The choice of Sm14 was motivated by the global importance of schistosomiasis (2,4,22) and by the fact that the protein itself is one of the few vaccine candidates that consistently induces 50% protection against S. mansoni cercariae in experimental animal models (16,17,20,23). In addition, Sm14 affords 100% protection against F. hepatica, a recognized agricultural problem (23).…”

“…All DNA manipulations were carried out as previously described (19). The E. coli expression vector pAE has been previously described (1,17). The DNA sequence coding for TTFC was amplified by PCR from pET32a-Fc (18) with the forward primer 5ЈCGCGGATCCAAAAATCTG GATTGTTGGGTTGAT3Ј and the reverse primer 5ЈCCCAAGCTTGCGG CCGCATCGATTCACTGCAGATCATTTGTCCATCCTTC3Ј.…”

“…Schistosoma mansoni fatty acid-binding protein 14 (Sm14) and the 28-kDa glutathione S-transferase from Schistosoma haematobium (Sh28-GST) are now considered by the World Health Organization to be the target molecules for an antischistosome vaccine (2,3,4).The recombinant protein showed a protective activity against two parasitic worm species, S. mansoni and Fasciola hepatica, inducing a 35 to 60% reduction in the number of adult S. mansoni worms and a 100% reduction in the F. hepatica worm burden (16,17,20,23).…”