Gene l0017 encodes a second chaperone for EspA of enterohaemorrhagic Escherichia coli O157 : H7

Abstract

Escherichia coli O157:H7 tightly associates with host cells through the formation of a pedestal structure in which cell cytoskeleton rearrangement has been observed. These pathogenic properties have been attributed to an island, known as the locus of enterocyte effacement (LEE), located on the bacterial chromosome. Gene l0017 is one of the LEE genes that has been less well characterized. To understand further the function of the gene, an l0017-deleted mutant was created. The mutant lost type III protein secretion (TTS) capacity. In terms of intracellular components, there was a substantial decrease in the level of EspA, but no apparent effect on Tir and EspB was observed. Fractionation of the bacterial proteins indicated that L0017 was part of the inner-membrane fraction. This association with the membrane is consistent with the hypothesis that L0017 may act as one of the TTS components. In addition, L0017 was found to affect regulation of EspA at a post-transcriptional level. The presence of L0017 readily stabilized EspA and the interaction between L0017 and EspA was demonstrated by their co-purification as well as by a bacterial two-hybrid system. Therefore, L0017 is a chaperone, the second chaperone identified in this system after CesAB, and escorts EspA, a protein with a great tendency to polymerize.

Identification of a Third EspA-binding Protein That Forms Part of the Type III Secretion System of Enterohemorrhagic Escherichia coli

“…Intriguingly, the reporter activity of pairing L0050 and EspA was as strong as that of the positive control, which involved the interaction of CesA2 with EspA ( Fig. 7C) (20). These genetic results strongly suggest that the interaction between EspA and L0050 does occur and that it is independent of the other LEE island-encoded proteins.…”

“…Secretion of the TTS translocators requires the assistance of cytoplasmic chaperones that have some common properties, namely that they have a low molecular mass (Ͻ15 kDa), have an acidic pI, and contain a C-terminal amphipathic helix (41). Up to now two chaperones (CesAB and CesA2) are reported to act with EspA (20,29,40), two (CesD and CesD2) with EspD (7,31,42), and one (CesAB) with EspB (29,40). CesD, CesD2, CesAB, and CesA2 all have chaperone properties as described above except that CesAB has a basic pI.…”

“…An EspA-LacZ translational fusion construct pALE and a transcriptional fusion construct pALT were generated using pKM005 as the vector (20). In the first case, an espA fragment was PCR-amplified from pEspA using the primers XT5 (GCTCTAGACCCGAAAAGTGCCACCTG) and ESPARB (TTGGATCCTTACCAAGGGATATTGC).…”

“…In the first case, an espA fragment was PCR-amplified from pEspA using the primers XT5 (GCTCTAGACCCGAAAAGTGCCACCTG) and ESPARB (TTGGATCCTTACCAAGGGATATTGC). The PCR product was digested with XbaI and BamHI and ligated into pKM005 (20) that was treated with the same enzymes to produce pALE. In the second case, an espA fragment was PCR-amplified using the primers XT5 and ESPARX (GCT-CTAGATTATTTACCAAGGGATATTGC).…”

Functional Characterization of SsaE, a Novel Chaperone Protein of the Type III Secretion System Encoded by Salmonella Pathogenicity Island 2

“…For example, EspA of EPEC is one of the T3SS substrates that forms a needle structure on the bacterial membrane surface, and efficient secretion of EspA requires two distinct chaperones, CesAB and CesA2. These chaperones increase the stability of EspA and show direct EspA-binding activity (12,13,52). Recently, it has been reported that EscL, in addition to CesAB and CesA2, interacts directly with EspA, enhances the stability of intracellular EspA, and is also essential for the complete secretion of EspA (33).…”