Gene expression of pro- and anti-apoptotic proteins in rock bream (Oplegnathus fasciatus) infected with megalocytivirus (family Iridoviridae)

Jung, Myung-Hwa; Nikapitiya, Chamilani; Song, Jung‐Min; Lee, Jehee; Oh, Myung‐Joo; Jung, Sung‐Ju

doi:10.1016/j.fsi.2014.01.012

Cited by 49 publications

(43 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The generation of the standard curve for the RBIV MCP gene copy numbers from the qRT‐PCR was as previously described (Jung et al . ). As MCP‐F 5′ tgcacaatctagttgaggaggtg 3′ and MCP‐R 5′ aggcgttccaaaagtcaagg 3′ primer sequences showed 100% identity with both FLIV and RBIV coding sequences, this primer set was used to determine both the RBIV and FLIV MCP copy numbers.…”

Section: Methodsmentioning

confidence: 97%

Low pathogenicity of flounder iridovirus (FLIV) and the absence of cross‐protection between FLIV and rock bream iridovirus

Jung

Lee

Jung

2016

Journal of Fish Diseases

View full text Add to dashboard Cite

The genus Megalocytivirus is known to infect a wide range of cultured marine fish. In this study, we examined the pathogenicity of FLIV (Megalocytivirus from olive flounder, genotype III) and RBIV (Megalocytivirus from rock bream, genotype I) to their homologous and heterologous host species. Olive flounder (7.5 ± 1.3 cm) injected with FLIV [major capsid protein (MCP) gene copies, 6.8 × 10 -6.5 × 10 /fish] at 24 °C did not die until 90 days post-infection (dpi). The average virus replication in the spleen peaked (1.27 × 10 /fish) at 20 dpi. Rock bream (6.5 ± 1.5 cm) injected with FLIV (8.8 × 10 and 6.5 × 10 /fish of MCP copies) showed no mortality until 50 dpi. The rock bream that survived after FLIV infection were rechallenged with RBIV at 50 dpi had 100% mortality, showing that there is no cross-protection between FLIV and RBIV. Temperature shifting (26 °C and 20 °C at 12 h intervals) did not cause FLIV-specific mortality into olive flounder, but higher virus copies were observed in the fish exposed to higher stocking density. This study demonstrates that FLIV and RBIV have different antigenic and pathogenic characteristics and that FLIV has low pathogenicity to olive flounder.

show abstract

Section: Methodsmentioning

confidence: 97%

Low pathogenicity of flounder iridovirus (FLIV) and the absence of cross‐protection between FLIV and rock bream iridovirus

Jung

Lee

Jung

2016

Journal of Fish Diseases

View full text Add to dashboard Cite

show abstract

“…The megalocytivirus RBIV up-regulates pro-apoptotic factors (Fas ligand and Fas) and an apoptosis inhibitory factor (inhibitor of apoptosis 1), which correlates with fish mortality [50]. miR-homoHSV from the Singapore grouper iridovirus (SGIV) inhibits SGIV-induced expression of the pro-apoptotic factor LITAF, which attenuates cell death [51].…”

Section: The Role Of the Pro-apoptotic Genes Bax And Bak In Cell Deathmentioning

confidence: 99%

Giant seaperch iridovirus infection upregulates Bas and Bak expression, leading to apoptotic death of fish cells

Chen

Wen

Hui

et al. 2015

Fish & Shellfish Immunology

View full text Add to dashboard Cite

“…A similar expression pattern was observed in the lowmortality group (18% expected mortality at 30 days p.i. ), which was characterized by a delayed low level of expression with lower viral loads than those in the high-mortality group (Jung et al, 2014). Perforin, granzyme and Fas ligand expression was significantly higher in the low-mortality group than in the control group at several time points until 30 days p.i.…”

Section: Rock Bream Iridovirusmentioning

confidence: 88%

“…Significantly higher IAP1 expression was observed at 10 days, 20 days and 22 days p.i. in the low-mortality group when compared with the control group (Jung et al, 2014).…”

Section: Rock Bream Iridovirusmentioning

confidence: 89%

“…One study analyzed two groups of fishes from two different water temperatures, one group with high mortality (100%) kept in water at 26 • C and another group with low mortality kept in water at 23 • C for 7 days and then transferred to 17 • C water after RBIV infection. Both groups were further studied by checking the expression level of apoptotic factors at different time points during disease progression and recovery to determine the reaction of apoptotic factor(s) after RBIV infection (Jeong et al, 2011;Jung et al, 2014). In the highmortality group (100% mortality at 15 days p.i.…”

Section: Rock Bream Iridovirusmentioning

confidence: 99%

See 1 more Smart Citation

Aquatic viruses induce host cell death pathways and its application

Reshi

Wang

et al. 2016

Virus Research

View full text Add to dashboard Cite

Gene expression of pro- and anti-apoptotic proteins in rock bream (Oplegnathus fasciatus) infected with megalocytivirus (family Iridoviridae)

Cited by 49 publications

References 62 publications

Low pathogenicity of flounder iridovirus (FLIV) and the absence of cross‐protection between FLIV and rock bream iridovirus

Low pathogenicity of flounder iridovirus (FLIV) and the absence of cross‐protection between FLIV and rock bream iridovirus

Giant seaperch iridovirus infection upregulates Bas and Bak expression, leading to apoptotic death of fish cells

Aquatic viruses induce host cell death pathways and its application

Contact Info

Product

Resources

About