Gene expression in nematode-infected plant roots

Abstract

A major pathogen of potato plants (Solanum tuberosum) is the potato cyst nematode (Globodera spp.), which induces localized redifferentiation of a limited number of host cells to form a specialized feeding-site termed the syncytium. A novel strategy utilizing the polymerase chain reaction (PCR) was employed to construct a cDNA library from dissected potato roots highly enriched in syncytial material. The library was differentially screened with cDNA probes derived from the infected root tissue from a compatible interaction and from healthy root tissue. Characterization of one gene identified by the library screen indicated an expression pattern that correlated with events in the immediate vicinity of the pathogen after syncytial establishment. The strategy for library construction and screening could be applicable to the study of gene expression in any plant-pathogen interaction in which the limited supply of cells at the interface of the two organisms precludes a more traditional approach.

Isolation and Localization of New Germination-related Sequences from Wheat Embryos

“…The primer sequences (5'-3') were TTATGAGTATTTCTTCCAGGG and AGCAAGTTCAGCCTGGTTAAG, respectively. The procedure for library amplification followed the method of Gurr et al (1991). Next,10 4 pfu of bacteriophage suspension (1 µl) was added to a reaction mixture that contained 10 mM Tris-Cl, pH 8.8, 50 mM KCl, 1.4 mM MgCl 2 , 4 mM dNTPs, 20 pmol biotinylated primers, and 0.1% Triton X-100 in a final reaction volume of 50 µl.…”

Nematode Pathogenesis and Resistance in Plants

“…Nevertheless, cDNA libraries have been constructed from RNA of isolated giant cells, galls, and syncytia, and genes that are upregulated after nematode infection have been identified from these libraries (Gurr et al, 1991;Wilson et al, 1994;Van der Eycken et al, 1996). A giant cell cDNA library constructed by a subtractive approach included sequences encoding a plasmalemmal proton ATPase, a putative Myb-type transcription factor, and the largest subunit of RNA polymerase II .…”

Differential molecular responses to abscisic acid and osmotic stress in viviparous maize embryos

“…Some embryos were frozen directly in liquid nitrogen, and then stored at -70 ~ C. Other embryos were cultured on filter paper soaked in liquid media containing MS basal salts (Murashige and Skoog 1962) Isolation ofRNA. A guanidine-hydrochloride-containing buffer was used for the extraction of RNA, as described by Gurr et al (1991).…”