Gene Expression and Silencing Studies in Phytophthora infestans Reveal Infection-Specific Nutrient Transporters and a Role for the Nitrate Reductase Pathway in Plant Pathogenesis

Abstract

To help learn how phytopathogens feed from their hosts, genes for nutrient transporters from the hemibiotrophic potato and tomato pest Phytophthora infestans were annotated. This identified 453 genes from 19 families. Comparisons with a necrotrophic oomycete, Pythium ultimum var. ultimum, and a hemibiotrophic fungus, Magnaporthe oryzae, revealed diversity in the size of some families although a similar fraction of genes encoded transporters. RNA-seq of infected potato tubers, tomato leaves, and several artificial media revealed that 56 and 207 transporters from P. infestans were significantly up- or down-regulated, respectively, during early infection timepoints of leaves or tubers versus media. About 17 were up-regulated >4-fold in both leaves and tubers compared to media and expressed primarily in the biotrophic stage. The transcription pattern of many genes was host-organ specific. For example, the mRNA level of a nitrate transporter (NRT) was about 100-fold higher during mid-infection in leaves, which are nitrate-rich, than in tubers and three types of artificial media, which are nitrate-poor. The NRT gene is physically linked with genes encoding nitrate reductase (NR) and nitrite reductase (NiR), which mobilize nitrate into ammonium and amino acids. All three genes were coregulated. For example, the three genes were expressed primarily at mid-stage infection timepoints in both potato and tomato leaves, but showed little expression in potato tubers. Transformants down-regulated for all three genes were generated by DNA-directed RNAi, with silencing spreading from the NR target to the flanking NRT and NiR genes. The silenced strains were nonpathogenic on leaves but colonized tubers. We propose that the nitrate assimilation genes play roles both in obtaining nitrogen for amino acid biosynthesis and protecting P. infestans from natural or fertilization-induced nitrate and nitrite toxicity.

Genome‐wide characterization of Phytophthora infestans metabolism: a systems biology approach

“…Abrahamian et al . () silenced the genes encoding nitrate and nitrite reductase, and their results suggested a role of these genes in virulence. Although both genes are included in our model, they were not marked as essential based on the SGD simulations, suggesting alternative routes for nitrogen metabolism.…”

“…However, a reduced concentration of all amino acids was found in zoospores compared with other life stages (Grenville‐Briggs et al ., ). As pointed out earlier, the expression of enzymes in the nitrogen metabolism pathway is highly dynamic and depends on the available nutrients (Abrahamian et al ., ). Possibly, the nitrogen imported during the zoospore stage is stored and converted to amino acids at later life stages.…”

“…To simulate the metabolite exchange between subcellular compartments, the model must also include intracellular transport reactions. Although nutrient transporters in P. infestans have been studied (Abrahamian et al ., ; Grenville‐Briggs et al ., ), hardly anything is known about the metabolites that are exchanged between the cytosol and subcellular compartments. The annotated substrates for transporter proteins are not specific, and are therefore hard to integrate into the metabolic model.…”

“…biosynthesis of various amino acids) were up‐regulated in cysts and during mycelial growth (Ah‐Fong et al ., ; Grenville‐Briggs et al ., ). Moreover, elevated expression in planta of various nutrient transporter genes suggests a rich influx of nutrients during infection (Abrahamian et al ., ). Transcriptome studies have analysed the metabolism of P. infestans from a regulatory point of view.…”

Phosphagen kinase function in flagellated spores of the oomycete Phytophthora infestans integrates transcriptional regulation, metabolic dynamics and protein retargeting

“…RT‐qPCR was performed as described by Abrahamian et al (). In brief, primers were designed to amplify regions from the 3’ end of PiPK1 (5’‐ gcagctctccaaggagtcag , 5’‐ cacctccgaatagccgatac ) and PiPK2 ( 5 ’ ‐gaagacgttcctggtgtggt, 5 ’ ‐cgttgtgcatgaagccatac ).…”