Gene delivery corrects N-acetylglutamate synthase deficiency and enables insights in the physiological impact of L-arginine activation of N-acetylglutamate synthase

Abstract

The urea cycle protects the central nervous system from ammonia toxicity by converting ammonia to urea. N-acetylglutamate synthase (NAGS) catalyzes formation of N-acetylglutamate, an essential allosteric activator of carbamylphosphate synthetase 1. Enzymatic activity of mammalian NAGS doubles in the presence of L-arginine, but the physiological significance of NAGS activation by L-arginine has been unknown. The NAGS knockout (Nags−/−) mouse is an animal model of inducible hyperammonemia, which develops hyperammonemia without N-carbamylglutamate and L-citrulline supplementation (NCG + Cit). We used adeno associated virus (AAV) based gene transfer to correct NAGS deficiency in the Nags−/− mice, established the dose of the vector needed to rescue Nags−/− mice from hyperammonemia and measured expression levels of Nags mRNA and NAGS protein in the livers of rescued animals. This methodology was used to investigate the effect of L-arginine on ureagenesis in vivo by treating Nags−/− mice with AAV vectors encoding either wild-type or E354A mutant mouse NAGS (mNAGS), which is not activated by L-arginine. The Nags−/− mice expressing E354A mNAGS were viable but had elevated plasma ammonia concentration despite similar levels of the E354A and wild-type mNAGS proteins. The corresponding mutation in human NAGS (NP_694551.1:p.E360D) that abolishes binding and activation by L-arginine was identified in a patient with NAGS deficiency. Our results show that NAGS deficiency can be rescued by gene therapy, and suggest that L-arginine binding to the NAGS enzyme is essential for normal ureagenesis.

Gene Therapy in Combination with Nitrogen Scavenger Pretreatment Corrects Biochemical and Behavioral Abnormalities of Infant Citrullinemia Type 1 Mice

“…However, the only curative treatment is liver transplantation. Interestingly, gene therapy based on rAAV administered to adult mice has proven to improve lifespan, weight gain and some biochemical parameters in several UCD mouse models, namely for deficiencies of OTC [ 24 , 25 ], ARG1 [ 24 ], CPS1 [ 27 ], NAGS [ 40 ], ASA [ 41 , 42 ] and CTLN1 [ 34 , 35 ]. Moreover, a phase 1/2 clinical trial based on rAAV administration to treat late onset OTC in adults has shown significant therapeutic results (NCT02991144, NCT03636438), leading to the prompt initiation of an ongoing phase 3 randomized, double-blind, placebo-controlled cross-over clinical trial (NCT05345171).…”

Noncoding sequence variants define a novel regulatory element in the first intron of the N ‐acetylglutamate synthase gene

“…Plasmid Prom‐Ex1‐Int1‐Luc (Sonaimuthu et al, 2021) was a template for the introduction of the NM_153006.2:c.427‐222G>A and NM_153006.2:c.427‐218A>C sequence changes. Mutagenic primers 5ʹ‐CCGACCTTGGATTCCGGGACATCTTTGGGGG‐3ʹ and 5ʹ‐CCCCCAAAGATGTCCCGGAATCCAAGGTCGG‐3ʹ were used to generate the c.427‐222G>A sequence change while primers 5ʹ‐TCCCTCCGACCTGGGACTCCGGGAC‐3ʹ and 5ʹ‐GTCCCGGAGTCCCAGGTCGGAGGGA‐3ʹ were used for the c.427‐218A>C sequence change.…”

“…Culturing of the HepG2 cells (ATCC) and the HuH‐7 cells (Charles Rice laboratory, Rockefeller University), their transfections, and reporter assays were carried out as described previously (Sonaimuthu et al, 2021; Williams et al, 2018).…”

“…Culturing of the HepG2 cells (ATCC) and the HuH-7 cells (Charles Rice laboratory, Rockefeller University), their transfections, and reporter assays were carried out as described previously (Sonaimuthu et al, 2021;Williams et al, 2018). Query of the gnomAD (Karczewski et al, 2020), dbSNP153 (Sherry et al, 2001), and 1000 Genomes Project (The 1000 Genomes Project Consortium, 2015) databases indicated that none of the four noncoding sequence variants have been previously reported.…”

“…The establishment of accurate molecular diagnostic methods for NAGSD is clinically important because the biochemical phenotype cannot be easily differentiated from other proximal urea cycle disorders, but unlike these other disorders, NAGSD can be effectively treated with NCG (Ah Mew & Caldovic, 2011; Haberle, 2011). Although most of the sequence variants causing NAGSD have been found in the NAGS coding region (Al Kaabi & El‐Hattab, 2016; Caldovic et al, 2007; Kim et al, 2015; Sancho‐Vaello et al, 2016; van de Logt et al, 2017), three pathogenic variants have been found in the noncoding regions (Heibel et al, 2012; Sonaimuthu et al, 2021; Williams et al, 2018). Therefore, understanding the NAGS gene regulation and the function of its regulatory elements is essential for confirming the pathological nature of sequence variants found in patients.…”