Gap Junctional Communication Modulates Gene Transcription by Altering the Recruitment of Sp1 and Sp3 to Connexin-response Elements in Osteoblast Promoters

Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

doi:10.1074/jbc.m212554200

Cited by 126 publications

(156 citation statements)

References 72 publications

Supporting

Mentioning

147

Contrasting

Order By: Relevance

“…We have previously shown that Cx43 gap junctions can regulate transcription from a Sp1/Sp3 binding "connexinresponse element" in the osteocalcin proximal promoter (OCN CxRE; Stains et al, 2003). To identify whether the FGF2-Cx43 synergistic effect on transcription is being mediated by Runx2, Sp1/Sp3, or both, we analyzed the effects of Cx43 and FGF2 on the Sp1/Sp3 binding OCN CxRE and the Runx2 cognate (p6xOSE2) luciferase reporters.…”

Section: Synergistic Activation Of Osteocalcin Transcription By Fgf2 mentioning

confidence: 99%

“…Previously, we have shown that disruption of Cx43 can reduce transcription of the osteocalcin gene in response to This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E08 -10 -1079) on April 1, 2009. treatment with serum by modulating signal transduction (Stains et al, 2003;Stains and Civitelli, 2005b). Ultimately, we showed that disruption of Cx43 function results in a decrease in the magnitude of the extracellular signal-regulated kinase (ERK) activation, resulting in a shift in the transcription factor occupancy of the osteocalcin promoter, decreasing osteocalcin transcription.…”

Section: Introductionmentioning

confidence: 98%

“…Previously, we have shown that disruption of Cx43 can reduce transcription of the osteocalcin gene in response to treatment with serum by modulating signal transduction (Stains et al, 2003;Stains and Civitelli, 2005b To expand on our knowledge of the molecular mechanisms by which gap junctions amplify osteoblast responses and to move closer toward identifying biologically relevant second messengers that pass through the Cx43 gap junctions in osteoblasts, we have examined the influence of Cx43 on the activation of osteoblast transcription by FGF2. FGF2 is an important regulator of skeletal tissue.…”

Section: Introductionmentioning

confidence: 99%

“…Chromatin immunoprecipitations (ChIPs) were performed as described previously, with the exception that the quantification of immunoprecipitated genomic DNA was assessed by real-time PCR (Stains et al, 2003). The osteocalcin proximal promoter primers were as follows: mOG2 Promoter: forward, AGCCTGGCAGTCTCCGATT, and reverse, ATGCTGTGGTTGGTGATTGC; mOG2 open reading frames (ORF): forward, GTGCTGCCCTAAAGCCAAAC, and reverse, GGACAGGGAGGATCAAGTTCTG.…”

Section: Chromatin Immunoprecipitationsmentioning

confidence: 99%

“…To test this hypothesis, we utilized a model of connexin45 (Cx45) overexpression. Previously, we and others have reported that the overexpression of exogenous Cx45 in an endogenous Cx43 background results in diminished gap junction communication, leading to repressed gene transcription (Koval et al, 1995;Li et al, 1999;Martinez et al, 2002;Stains et al, 2003). Cells were transiently transfected with pcDNA-cCx45, SVFF-Cx43, or pcDNA.…”

mentioning

confidence: 99%

See 4 more Smart Citations

Connexin43 Potentiates Osteoblast Responsiveness to Fibroblast Growth Factor 2 via a Protein Kinase C-Delta/Runx2–dependent Mechanism

Lima

Niger

Hebert

et al. 2009

MBoC

Self Cite

100

View full text Add to dashboard Cite

In this study, we examine the role of the gap junction protein, connexin43 (Cx43), in the transcriptional response of osteocalcin to fibroblast growth factor 2 (FGF2) in MC3T3 osteoblasts. By luciferase reporter assays, we identify that the osteocalcin transcriptional response to FGF2 is markedly increased by overexpression of Cx43, an effect that is mediated by Runx2 via its OSE2 cognate element, but not by a previously identified connexin-responsive Sp1/Sp3-binding element. Furthermore, disruption of Cx43 function with Cx43 siRNAs or overexpression of connexin45 markedly attenuates the response to FGF2. Inhibition of protein kinase C delta (PKC␦) with rottlerin or siRNA-mediated knockdown abrogates the osteocalcin response to FGF2. Additionally, we show that upon treatment with FGF2, PKC␦ translocates to the nucleus, PKC␦ and Runx2 are phosphorylated and these events are enhanced by Cx43 overexpression, suggesting that the degree of activation is enhanced by increased Cx43 levels. Indeed, chromatin immunoprecipitations of the osteocalcin proximal promoter with antibodies against Runx2 demonstrate that the recruitment of Runx2 to the osteocalcin promoter in response to FGF2 treatment is dramatically enhanced by Cx43 overexpression. Thus, Cx43 plays a critical role in regulating the ability of osteoblasts to respond to FGF2 by impacting PKC␦ and Runx2 function. INTRODUCTIONBone formation and remodeling is a tightly organized and dynamic process that requires the coordinated action of osteoblasts, osteocytes, and osteoclasts to maintain bone homeostasis. It is hypothesized that osteoblasts and osteocytes coordinate their activities, at least in part, through direct cell-to-cell communication through gap junctions. Gap junctions are composed of connexins, a family of transmembrane proteins that constitute the intercellular gap junction channels (Beyer et al., 1990). Six connexins assemble to make up the gap junction hemichannel on the plasma membrane of one cell, which docks with a hemichannel on an adjacent cell to form an aqueous gap junction channel. The resultant gap junctions provide direct conduits for the passage of ions and other low molecular weight molecules, including second messengers, among cells.The gap junction protein connexin43 (Cx43) is abundantly expressed in both osteoblasts and osteocytes, where it has been hypothesized to transmit hormonal signals, mechanical load, and growth factor cues among cells in order to coordinate the synthesis of new bone (reviewed in Stains and Civitelli, 2005a;Jiang et al., 2007). Genetic ablation of gja1, the gene encoding Cx43, in mice leads to a severe delay in the ossification of both intramembranous and endochondral derived skeletal elements during embryonic development (Lecanda et al., 2000). The bones of these animals are remarkably brittle, and the osteoblasts isolated from the Cx43 null animals are dysfunctional, with reduced osteogenic and mineralizing capacity (Lecanda et al., 2000). These Cx43-deficient mice die at birth because of a defect in cardiac f...

show abstract

Section: Synergistic Activation Of Osteocalcin Transcription By Fgf2 mentioning

confidence: 99%

Section: Introductionmentioning

confidence: 98%

Section: Introductionmentioning

confidence: 99%

Section: Chromatin Immunoprecipitationsmentioning

confidence: 99%

mentioning

confidence: 99%

See 3 more Smart Citations

Connexin43 Potentiates Osteoblast Responsiveness to Fibroblast Growth Factor 2 via a Protein Kinase C-Delta/Runx2–dependent Mechanism

Lima

Niger

Hebert

et al. 2009

MBoC

Self Cite

100

View full text Add to dashboard Cite

show abstract

Cell‐cell interactions in regulating osteogenesis and osteoblast function

Stains

Civitelli

2005

Birth Defects Research Pt C

Self Cite

View full text Add to dashboard Cite

Endochondral bone formation requires an elaborate interplay among autocrine, paracrine, and endocrine signals, positional cues, and cell-cell contacts to mediate the complex three-dimensional architecture and function of the skeleton. Embryonic bone development occurs by migration, aggregation, and condensation of immature mesenchymal progenitor cells to form the cartilaginous anlage. Upon vascular invasion, the cartilaginous scaffold is colonized and subsequently mineralized by osteoblasts. Likewise, bone remodeling in the adult skeleton is a dynamic process that requires coordinated cellular activities among osteoblasts, osteocytes, and osteoclasts to maintain bone homeostasis. This review examines the role of cell-cell interactions mediated by adherens junctions formed by cadherins and communicative gap junctions formed by connexins in regulating bone development and osteogenic function.

show abstract

Gap junctional signaling in pattern regulation: Physiological network connectivity instructs growth and form

Mathews

Levin

2016

Developmental Neurobiology

121

View full text Add to dashboard Cite

Gap junctions (GJs) are aqueous channels that allow cells to communicate via physiological signals directly. The role of gap junctional connectivity in determining single-cell functions has long been recognized. However, GJs have another important role: the regulation of large-scale anatomical pattern. GJs are not only versatile computational elements that allow cells to control which small molecule signals they receive and emit, but also establish connectivity patterns within large groups of cells. By dynamically regulating the topology of bioelectric networks in vivo, GJs underlie the ability of many tissues to implement complex morphogenesis. Here, a review of recent data on patterning roles of GJs in growth of the zebrafish fin, the establishment of left-right patterning, the developmental dysregulation known as cancer, and the control of large-scale head-tail polarity, and head shape in planarian regeneration has been reported. A perspective in which GJs are not only molecular features functioning in single cells, but also enable global neural-like dynamics in non-neural somatic tissues has been proposed. This view suggests a rich program of future work which capitalizes on the rapid advances in the biophysics of GJs to exploit GJ-mediated global dynamics for applications in birth defects, regenerative medicine, and morphogenetic bioengineering. © 2016 Wiley Periodicals, Inc. Develop Neurobiol 77: 643-673, 2017.

show abstract

Gap Junctional Communication Modulates Gene Transcription by Altering the Recruitment of Sp1 and Sp3 to Connexin-response Elements in Osteoblast Promoters

Cited by 126 publications

References 72 publications

Connexin43 Potentiates Osteoblast Responsiveness to Fibroblast Growth Factor 2 via a Protein Kinase C-Delta/Runx2–dependent Mechanism

Connexin43 Potentiates Osteoblast Responsiveness to Fibroblast Growth Factor 2 via a Protein Kinase C-Delta/Runx2–dependent Mechanism

Cell‐cell interactions in regulating osteogenesis and osteoblast function

Gap junctional signaling in pattern regulation: Physiological network connectivity instructs growth and form

Contact Info

Product

Resources

About