G-quadruplexes rescuing protein folding

Abstract

Maintaining the health of the proteome is a critical cellular task. Recently, we found G-quadruplex (G4) nucleic acids are especially potent at preventing protein aggregation in vitro and could at least indirectly improve the protein folding environment of E. coli. However, the roles of G4s in protein folding were not yet explored. Here, through in vitro protein folding experiments, we discover that G4s can accelerate protein folding by rescuing kinetically trapped intermediates to both native and near-native folded states. Time-course folding experiments in E. coli further demonstrate that these G4s primarily improve protein folding quality in E. coli as opposed to preventing protein aggregation. The ability for a short nucleic acid to rescue protein folding opens up the possibility of nucleic acids and ATP-independent chaperones to play considerable roles in dictating the ultimate folding fate of proteins.

Manipulating TDP43 Aggregation via RNA G-quadruplexes

“…Before testing the effects of G4s on TDP43 in yeast, the presence of the far-red nuclear death stain DRAQ7, and the 6FAM labeled G4s in the yeast cells were also confirmed by confocal microscopy, as was the expressing of DsRED-tagged protein (Supplementary Figure 6). When TDP43-DsRED expressing yeast were coincubated with G4 DNA displaying previously identified chaperone activity, LTRIII or seq576 seq576 (5' TGTCGGGCGGGGAGGGGGGG 3') 31 , the amount of G4 accumulated before cell death increased at similar levels to the evolved TDP43 binders (Figure 1c). The amount of TDP43 present in cells also increased as a function of time incubated with the G4 (Figure 1d) and as a function of G4 concentration (Figure 1e).…”

“…To test different states of TDP43 as starting points for aggregation, we isolated both the dimer peak and a small aggregate peak from the SEC at the end of protein purification. LTRIII DNA (5' GGGAGGCGTGGCCTGGGCGGGACTGGGG 3'), a G4 previously demonstrated to have potent chaperone activity 31 , was selected to screen with TDP43 and labeled with 6FAM on the 3' end. The G4 LTRIII-FAM was then mixed with 50 µM eGFP-TDP43 aggregate as separated by size exclusion chromatography (Supplementary Figure 1), and monitored for aggregation and disaggregation via absorbance at 395 nm (Figure 1 a,b, Supplementary Figure 2).…”

An intein‐based biosensor to measure protein stability in vivo

“…Similar to many other fluorescent proteins, TagRFP675 exhibits a slow maturation time (Balleza et al, 2018), resulting in kinetically trapped intermediates and poor folding in E. coli (Son et al, 2023). With the assistance of molecular chaperones, such as GroEL, TagRFP675 can overcome kinetic barriers to fold properly in E. coli (Son et al, 2023). Therefore, we used TagRFP675 to further investigate whether the reporter activity of the intein biosensor is correlated with the folding status of POI in the presence or absence of GroEL (Figure 2).…”

“…To test this possibility, we employed a fluorescent protein, TagRFP675, as the POI. Similar to many other fluorescent proteins, TagRFP675 exhibits a slow maturation time (Balleza et al, 2018), resulting in kinetically trapped intermediates and poor folding in E. coli (Son et al, 2023). With the assistance of molecular chaperones, such as GroEL, TagRFP675 can overcome kinetic barriers to fold properly in E. coli (Son et al, 2023).…”

Catalytic Relaxation of Kinetically Trapped Intermediates by DNA Chaperones

“…Misfolded protein structures can be escorted into thermodynamically stable species, assisted by chaperone proteins that catalyze correct folding. 10,11 In nucleic acid-based biomaterials such as DNA origamis, 12−15 such chaperones 16,17 are rarely applied. This presents a hurdle for rapid self-assembly, in which kinetically trapped misfolded states are generally avoided to ensure that correct structures are homogeneously assembled.…”