Further insights into how low-light signaling delays leaf senescence in soybean under high-temperature

Bawa, George; Chen, Guopeng; Shi, Jianyi; Chen, Ping; Feng, Lingyang; Tian, Pu; Yang, Huan; Chen, Hong; Shi, Kai; Hu, Yun; Lian, Bing; Cheng, Bin; Xiao, Ting; Memon, Shafiq ur Rehman; Yang, Feng; Yong, Taiwen; Liu, Jiang; Liu, Weiguo; Wang, Xiaochun; Yang, Wenyu

doi:10.1016/j.envexpbot.2021.104516

Cited by 4 publications

(2 citation statements)

References 58 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Upregulation of chlorophyll catabolism genes was also observed under heat stress induced leaf senescence in tall fescue (Qian et al 2020). In soybean heat stress induced senescence resulted in downregulation of stay green genes GmSGR1 and GmSGR2 coupled with decline in chlorophyll content and photosynthesis rate (Bawa et al 2021). By analyzing chlorophyll biosynthesis and degradation enzymes activities or their gene expression in bent grass during heat stress it was observed that the chlorophyll loss under heat stress was mainly due to the degradation activities (Jespersen et al 2016).…”

Section: Discussionmentioning

confidence: 99%

Developing grains influence terminal senescence and heat stress response by regulating oxidative stress and defense in wheat flag leaves

Semwal,

Khanna-Chopra

2023

Preprint

View full text Add to dashboard Cite

Heat stress at grain development is a major threat for global wheat production systems. This study investigated the impact of high temperature stress on wheat cultivar HW2041 and its cytoplasmic male sterile (CMS) line during grain development and its effects on leaf senescence and antioxidant defense mechanisms. Late-sown wheat crops experienced extreme high temperature stress, resulting in a shorter grain growth duration compared to normal-sown crops. Heat stress accelerated leaf senescence, as indicated by a faster decline in green flag leaf area, chlorophyll, and protein content. However, the CMS line exhibited delayed senescence and maintained higher levels of these parameters under heat stress. Heat stress also induced oxidative stress, with increased levels of reactive oxygen species (ROS), lipid peroxidation, and protein oxidation. However, the CMS line displayed better antioxidant defense mechanisms, including higher activities of antioxidant enzymes, superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), peroxidase (POX) and increased levels of ascorbate (AsA) and glutathione (GSH). Moreover, the CMS line exhibited better defense mechanisms in the chloroplast and mitochondria compared to the fertile line, indicating their involvement in regulating senescence and stress responses. Our findings suggest that the CMS line possesses improved heat stress tolerance and a more efficient antioxidant defense system, contributing to delayed senescence and reduced oxidative damage. This study provides valuable insights into the effects of high temperature stress on wheat and highlights the importance of genetic variations in heat stress tolerance.

show abstract

Section: Discussionmentioning

confidence: 99%

Developing grains influence terminal senescence and heat stress response by regulating oxidative stress and defense in wheat flag leaves

Semwal,

Khanna-Chopra

2023

Preprint

View full text Add to dashboard Cite

show abstract

“…The data analysis was conducted using the 2 − CT method. The determination of Cycle threshold (C t ) values was performed by subtracting the levels difference of Ct (Zhou et al, 2019b;Bawa et al, 2020Bawa et al, , 2021. The ZmACTIN-F-(TCACTACGACTGCCGAGCGAG)-R-(GAGCC ACCACTGAGGACAACATTAC) gene was used as a housekeeping gene.…”

Section: Indole-3-acetic Acid Concentration and Key Biosynthesis Pathway Genes Analysismentioning

confidence: 99%

Gravity Reduced Nitrogen Uptake via the Regulation of Brace Unilateral Root Growth in Maize Intercropping

Chen¹,

Liang²,

Bawa³

et al. 2021

Front. Plant Sci.

Self Cite

View full text Add to dashboard Cite

Water, nutrient, light, and interspecific facilitation regulation of soil physicochemical properties and root morphology modulate nitrogen (N) uptake in cereal and legume intercropping systems. However, maize root morphological plasticity and N uptake capability response to gravity in the intercropping system remains to be determined. In this study, maize was grown under 20 cm (I20), 40 cm (I40), and 60 cm (I60) of narrow row spacing in an intercropping system (maize–soybean strip relay intercropping) and equal row spacing of monoculture (M) in a 2-year field experiment. As a supplementary for the field experiment, maize root barrier and plant inclination experiments were conducted. Plant inclination, brace root morphology, N uptake, indole-3-acetic acid (IAA) level, IAA synthesis genes, and grain yield were assessed. The result showed that the plant inclination increased with decreasing narrow row spacing in intercropping system. Also, the brace unilateral root growth ratio (BURR) increased with increasing plant inclination in intercropping treatments. The plant inclination experiment showed the BURR achieved 94% after inclination at 45°. BURR tended to be positively correlated (p = 0.00) with plant inclination. Thus, gravity (plant inclination) causes brace unilateral root growth. The IAA concentration of stem nodes in the wide row increased with increasing plant inclination, while the IAA accumulation decreased in the narrow row. The Zmvt2 and ZM2G141383 genes (associated with IAA biosynthesis) were highly expressed in a wide row. There was a strong correlation (p = 0.03) between the IAA concentration of wide row and the BURR. Therefore, gravity regulates the IAA level, which affects BURR. In addition, the brace root number, volume, and surface area were decreased when BURR was increased. Subsequently, the leaf N, cob N, and kernel N accumulation were reduced. These organs N and grain yield in I60 were not significantly different as compared to the control treatment. The excessive brace unilateral root growth was not conducive to N uptake and increased yield. Our results suggest that gravity is essential in regulating root morphology plasticity by regulating IAA levels and decreasing N uptake capacity. Furthermore, these results indicate that plant inclination can regulate root phenotype and N uptake of maize and by adjusting the spacing of narrow maize row, we can improve the N uptake and yield of the maize–soybean strip relay-intercropping system.

show abstract

Shade stress triggers ethylene biosynthesis to accelerate soybean senescence and impede nitrogen remobilization

Deng,

Huang,

Chen

et al. 2024

Plant Physiology and Biochemistry

View full text Add to dashboard Cite

Further insights into how low-light signaling delays leaf senescence in soybean under high-temperature

Cited by 4 publications

References 58 publications

Developing grains influence terminal senescence and heat stress response by regulating oxidative stress and defense in wheat flag leaves

Developing grains influence terminal senescence and heat stress response by regulating oxidative stress and defense in wheat flag leaves

Gravity Reduced Nitrogen Uptake via the Regulation of Brace Unilateral Root Growth in Maize Intercropping

Shade stress triggers ethylene biosynthesis to accelerate soybean senescence and impede nitrogen remobilization

Contact Info

Product

Resources

About